Histopathological examination of newly-developed adhesive silicone denture relining material.

We aimed to guage the subcutaneous tissue response to a newly developed adhesive silicone denture relining materials, SG, (Neo Dental Chemical Products Co., Ltd. Tokyo, Japan). We embedded the experimental materials SG and one other present management materials, Roeko Seal (RS), within the dorsal space of 22 male ddY mice.

One week and 12 weeks after the embedding, the tissues surrounding the embedded supplies had been eliminated and a histopathological examination was carried out. The outcomes reveal that the essential histopathological elements are the formation of granulation tissue and the change of the tissue to fibrous capsule over time.

The outcomes means that the newly-developed SG is secure as in contrast with the management RS, whose composition is comparable.

Histopathological examination of newly-developed adhesive silicone denture relining material.
Histopathological examination of newly-developed adhesive silicone denture relining materials.

Collaborative research on fifteen compounds within the rat-liver Comet assay built-in into 2- and 4-week repeat-dose research.

A collaborative trial was carried out to guage the likelihood of integrating the rat-liver Comet assay into repeat-dose toxicity research. Fourteen laboratories from Europe, Japan and the USA examined fifteen chemical compounds.

Two chemical compounds had been beforehand proven to induce micronuclei in an acute protocol, however had been discovered unfavorable in a 4-week Micronucleus (MN) Assay (benzo[a]pyrene and 1,2-dimethylhydrazine; Hamada et al., 2001); 4 genotoxic rat-liver carcinogens that had been unfavorable within the MN assay in bone marrow or blood (2,6-dinitrotoluene, dimethylnitrosamine, 1,2-dibromomethane, and 2-amino-3-methylimidazo[4,5-f]quinoline); three compounds used within the ongoing JaCVAM (Japanese Center for the Validation of Alternative Methods) validation research of the acute liver Comet assay (2,4-diaminotoluene, 2,6-diaminotoluene and acrylamide); three pharmaceutical-like compounds (chlordiazepoxide, pyrimethamine and gemifloxacin), and three non-genotoxic rodent liver carcinogens (methapyrilene, clofibrate and phenobarbital). Male rats obtained oral administrations of the take a look at compounds, each day for 2 or 4 weeks.

EDEM2 Antibody

40055-100ul 100ul
EUR 390


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EDEM2 Antibody

DF9503 200ul
EUR 304
Description: EDEM2 Antibody detects endogenous levels of total EDEM2.

EDEM2 Antibody

ABD9503 100 ug
EUR 438

EDEM2 Antibody

EUR 146

EDEM2 Antibody

46557-100ul 100ul
EUR 252

EDEM2 Antibody

EUR 349

EDEM2 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EDEM2. Recognizes EDEM2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200


PVT18710 2 ug
EUR 231


YF-PA19809 50 ul
EUR 363
Description: Mouse polyclonal to EDEM2


YF-PA19810 100 ug
EUR 403
Description: Rabbit polyclonal to EDEM2

Polyclonal EDEM2 Antibody

AMM07003G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human EDEM2 . This antibody is tested and proven to work in the following applications:

EDEM2 Conjugated Antibody

C46557 100ul
EUR 397

EDEM2 cloning plasmid

CSB-CL861146HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1737
  • Sequence: atgcctttccggctgctcatcccgctcggcctcctgtgcgcgctgctgcctcagcaccatggtgcgccaggtcccgacggctccgcgccagatcccgcccactacagggagcgagtcaaggccatgttctaccacgcctacgacagctacctggagaatgcctttcccttcgatg
  • Show more
Description: A cloning plasmid for the EDEM2 gene.

EDEM2 Polyclonal Antibody

A58890 100 µg
EUR 570.55
Description: kits suitable for this type of research

EDEM2 Polyclonal Antibody

ABP55756-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human EDEM2
  • Applications tips:
Description: A polyclonal antibody for detection of EDEM2 from Human. This EDEM2 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human EDEM2

EDEM2 Polyclonal Antibody

ABP55756-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human EDEM2
  • Applications tips:
Description: A polyclonal antibody for detection of EDEM2 from Human. This EDEM2 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human EDEM2

EDEM2 Polyclonal Antibody

ABP55756-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human EDEM2
  • Applications tips:
Description: A polyclonal antibody for detection of EDEM2 from Human. This EDEM2 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human EDEM2

EDEM2 Blocking Peptide

DF9503-BP 1mg
EUR 195

EDEM2 Blocking Peptide

EUR 153

EDEM2 Polyclonal Antibody

ES6755-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against EDEM2 from Human. This antibody is tested and validated for IHC, WB, ELISA

EDEM2 Polyclonal Antibody

ES6755-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against EDEM2 from Human. This antibody is tested and validated for IHC, WB, ELISA

anti- EDEM2 antibody

FNab02632 100µg
EUR 505.25
  • Immunogen: ER degradation enhancer, mannosidase alpha-like 2
  • Uniprot ID: Q9BV94
  • Gene ID: 55741
  • Research Area: Metabolism
Description: Antibody raised against EDEM2

Anti-EDEM2 antibody

PAab02632 100 ug
EUR 355

Anti-EDEM2 antibody

STJ92823 200 µl
EUR 197
Description: Rabbit polyclonal to EDEM2.

Anti-EDEM2 (2E4)

YF-MA11569 100 ug
EUR 363
Description: Mouse monoclonal to EDEM2

Human EDEM2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

EDEM2 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EDEM2. Recognizes EDEM2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

EDEM2 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EDEM2. Recognizes EDEM2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

EDEM2 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EDEM2. Recognizes EDEM2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA


ELI-32317h 96 Tests
EUR 824


EF009290 96 Tests
EUR 689

EDEM2 Recombinant Protein (Human)

RP010159 100 ug Ask for price

EDEM2 Recombinant Protein (Rat)

RP199049 100 ug Ask for price

EDEM2 Recombinant Protein (Mouse)

RP130856 100 ug Ask for price

EDEM2 Polyclonal Antibody, Biotin Conjugated

A58891 100 µg
EUR 570.55
Description: fast delivery possible

EDEM2 Polyclonal Antibody, FITC Conjugated

A58892 100 µg
EUR 570.55
Description: reagents widely cited

EDEM2 Polyclonal Antibody, HRP Conjugated

A58893 100 µg
EUR 570.55
Description: Ask the seller for details

EDEM2 ORF Vector (Human) (pORF)

ORF003387 1.0 ug DNA
EUR 95

Edem2 ORF Vector (Mouse) (pORF)

ORF043620 1.0 ug DNA
EUR 506

Edem2 ORF Vector (Rat) (pORF)

ORF066351 1.0 ug DNA
EUR 506

Edem2 sgRNA CRISPR Lentivector set (Mouse)

K3235601 3 x 1.0 ug
EUR 339

EDEM2 sgRNA CRISPR Lentivector set (Human)

K0653501 3 x 1.0 ug
EUR 339

Edem2 sgRNA CRISPR Lentivector set (Rat)

K7428201 3 x 1.0 ug
EUR 339

Monoclonal EDEM2 Antibody (clone 2E4), Clone: 2E4

AMM07004G 0.05mg
EUR 528
Description: A Monoclonal antibody against Human EDEM2 (clone 2E4). The antibodies are raised in Mouse and are from clone 2E4. This antibody is applicable in WB and IHC-P, E

Edem2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3235602 1.0 ug DNA
EUR 154

Edem2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3235603 1.0 ug DNA
EUR 154

Edem2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3235604 1.0 ug DNA
EUR 154

EDEM2 sgRNA CRISPR Lentivector (Human) (Target 1)

K0653502 1.0 ug DNA
EUR 154

EDEM2 sgRNA CRISPR Lentivector (Human) (Target 2)

K0653503 1.0 ug DNA
EUR 154

EDEM2 sgRNA CRISPR Lentivector (Human) (Target 3)

K0653504 1.0 ug DNA
EUR 154

Edem2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7428202 1.0 ug DNA
EUR 154

Edem2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7428203 1.0 ug DNA
EUR 154

Edem2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7428204 1.0 ug DNA
EUR 154

EDEM2 Protein Vector (Rat) (pPB-C-His)

PV265402 500 ng
EUR 603

EDEM2 Protein Vector (Rat) (pPB-N-His)

PV265403 500 ng
EUR 603

EDEM2 Protein Vector (Rat) (pPM-C-HA)

PV265404 500 ng
EUR 603

EDEM2 Protein Vector (Rat) (pPM-C-His)

PV265405 500 ng
EUR 603

EDEM2 Protein Vector (Mouse) (pPB-C-His)

PV174478 500 ng
EUR 603

EDEM2 Protein Vector (Mouse) (pPB-N-His)

PV174479 500 ng
EUR 603

EDEM2 Protein Vector (Mouse) (pPM-C-HA)

PV174480 500 ng
EUR 603

EDEM2 Protein Vector (Mouse) (pPM-C-His)

PV174481 500 ng
EUR 603

EDEM2 Protein Vector (Human) (pPB-C-His)

PV013545 500 ng
EUR 329

EDEM2 Protein Vector (Human) (pPB-N-His)

PV013546 500 ng
EUR 329

EDEM2 Protein Vector (Human) (pPM-C-HA)

PV013547 500 ng
EUR 329

EDEM2 Protein Vector (Human) (pPM-C-His)

PV013548 500 ng
EUR 329

Edem2 3'UTR Luciferase Stable Cell Line

TU105598 1.0 ml Ask for price

Edem2 3'UTR GFP Stable Cell Line

TU155598 1.0 ml Ask for price

EDEM2 3'UTR Luciferase Stable Cell Line

TU006560 1.0 ml
EUR 1394

Edem2 3'UTR Luciferase Stable Cell Line

TU203777 1.0 ml Ask for price

EDEM2 3'UTR GFP Stable Cell Line

TU056560 1.0 ml
EUR 1394

Edem2 3'UTR GFP Stable Cell Line

TU253777 1.0 ml Ask for price

EDEM2 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV791509 1.0 ug DNA
EUR 316

EDEM2 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV791510 1.0 ug DNA
EUR 316

EDEM2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV650983 1.0 ug DNA
EUR 682

EDEM2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV650987 1.0 ug DNA
EUR 682

EDEM2 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV650988 1.0 ug DNA
EUR 682

ER Degradation Enhancer, Mannosidase Alpha-Like 2 (EDEM2) Antibody

abx036086-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

ER Degradation Enhancer, Mannosidase alpha-Like 2 (EDEM2) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

ER Degradation Enhancer, Mannosidase Alpha-Like 2 (EDEM2) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

ER Degradation Enhancer, Mannosidase Alpha-Like 2 (EDEM2) Antibody

abx232632-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

ER Degradation Enhancer, Mannosidase Alpha-Like 2 (EDEM2) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

ER Degradation Enhancer, Mannosidase Alpha-Like 2 (EDEM2) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

ER Degradation Enhancer, Mannosidase Alpha-Like 2 (EDEM2) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Edem2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3235605 3 x 1.0 ug
EUR 376

EDEM2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0653505 3 x 1.0 ug
EUR 376

Edem2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K7428205 3 x 1.0 ug
EUR 376

Human ER Degradation Enhancer, Mannosidase alpha-Like 2 (EDEM2) ELISA Kit

abx387046-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Edem2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K3235606 1.0 ug DNA
EUR 167

Edem2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K3235607 1.0 ug DNA
EUR 167

Edem2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K3235608 1.0 ug DNA
EUR 167

EDEM2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K0653506 1.0 ug DNA
EUR 167

EDEM2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K0653507 1.0 ug DNA
EUR 167

EDEM2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K0653508 1.0 ug DNA
EUR 167

EDEM2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV791507 1.0 ug DNA
EUR 374

EDEM2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV791508 1.0 ug DNA
EUR 374

EDEM2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV650984 1.0 ug DNA
EUR 682

EDEM2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV650985 1.0 ug DNA
EUR 740

EDEM2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV650986 1.0 ug DNA
EUR 740

Edem2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K7428206 1.0 ug DNA
EUR 167

Edem2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K7428207 1.0 ug DNA
EUR 167

Edem2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K7428208 1.0 ug DNA
EUR 167

The prime dose was meant to be the very best dose producing scientific indicators or histopathological results with out inflicting mortality, i.e. the 28-day most tolerated dose. The liver Comet assay was carried out in accordance with revealed suggestions and following the protocol for the continuing JaCVAM validation trial. Laboratories supplied liver Comet assay knowledge obtained on the finish of the long-term (2- or 4-week) research along with an analysis of liver histology.

Most of the take a look at compounds had been additionally investigated within the liver Comet assay after short-term (1-Three each day) administration to match the sensitivity of the 2 research designs. MN analyses had been carried out in bone marrow or peripheral blood for many of the compounds to find out whether or not the liver Comet assay might complement the MN assay for the detection of genotoxins after long-term therapy.

Most of the liver genotoxins had been optimistic and the three non-genotoxic carcinogens gave unfavorable end result within the liver Comet assay after long-term administration. There was a excessive concordance between short- and long-term Comet assay outcomes. Most compounds when examined as much as the utmost tolerated dose had been accurately detected in each short- and long-term research.

Discrepant outcomes had been obtained with 2,6 diaminotoluene (unfavorable within the short-term, however optimistic within the long-term research), phenobarbital (optimistic within the short-term, however unfavorable within the long-term research) and gemifloxacin (optimistic within the short-term, however unfavorable within the long-term research).

The total outcomes point out that the liver Comet assay will be built-in inside repeat-dose toxicity research and effectively enhances the MN assay in detecting genotoxins. Practical elements of integrating genotoxicity endpoints into repeat-dose research had been evaluated, e.g. by investigating the impact of blood sampling, as usually carried out throughout toxicity research, on the Comet and MN assays.

The bleeding protocols used right here didn’t have an effect on the conclusions of the Comet assay or of the MN assays in blood and bone marrow. Although bleeding typically elevated reticulocyte frequencies, the sensitivity of the response within the MN assay was not altered. 

Leave a Comment