Histopathological examination of newly-developed adhesive silicone denture relining material.

Histopathological examination of newly-developed adhesive silicone denture relining material.

We aimed to guage the subcutaneous tissue response to a newly developed adhesive silicone denture relining materials, SG, (Neo Dental Chemical Products Co., Ltd. Tokyo, Japan). We embedded the experimental materials SG and one other present management materials, Roeko Seal (RS), within the dorsal space of 22 male ddY mice.

One week and 12 weeks after the embedding, the tissues surrounding the embedded supplies had been eliminated and a histopathological examination was carried out. The outcomes reveal that the essential histopathological elements are the formation of granulation tissue and the change of the tissue to fibrous capsule over time.

The outcomes means that the newly-developed SG is secure as in contrast with the management RS, whose composition is comparable.

Histopathological examination of newly-developed adhesive silicone denture relining material.
Histopathological examination of newly-developed adhesive silicone denture relining materials.

Collaborative research on fifteen compounds within the rat-liver Comet assay built-in into 2- and 4-week repeat-dose research.

A collaborative trial was carried out to guage the likelihood of integrating the rat-liver Comet assay into repeat-dose toxicity research. Fourteen laboratories from Europe, Japan and the USA examined fifteen chemical compounds.

Two chemical compounds had been beforehand proven to induce micronuclei in an acute protocol, however had been discovered unfavorable in a 4-week Micronucleus (MN) Assay (benzo[a]pyrene and 1,2-dimethylhydrazine; Hamada et al., 2001); 4 genotoxic rat-liver carcinogens that had been unfavorable within the MN assay in bone marrow or blood (2,6-dinitrotoluene, dimethylnitrosamine, 1,2-dibromomethane, and 2-amino-3-methylimidazo[4,5-f]quinoline); three compounds used within the ongoing JaCVAM (Japanese Center for the Validation of Alternative Methods) validation research of the acute liver Comet assay (2,4-diaminotoluene, 2,6-diaminotoluene and acrylamide); three pharmaceutical-like compounds (chlordiazepoxide, pyrimethamine and gemifloxacin), and three non-genotoxic rodent liver carcinogens (methapyrilene, clofibrate and phenobarbital). Male rats obtained oral administrations of the take a look at compounds, each day for 2 or 4 weeks.

EDEM2 Antibody

EUR 146

EDEM2 Antibody

46557-100ul 100ul
EUR 252

EDEM2 Antibody

40055-100ul 100ul
EUR 390

EDEM2 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EDEM2. Recognizes EDEM2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

EDEM2 Antibody

DF9503 200ul
EUR 304
Description: EDEM2 Antibody detects endogenous levels of total EDEM2.

EDEM2 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against EDEM2. Recognizes EDEM2 from Human. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/10000


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EDEM2 Antibody

ABD9503 100 ug
EUR 438


PVT18710 2 ug
EUR 231


YF-PA19809 50 ul
EUR 363
Description: Mouse polyclonal to EDEM2


YF-PA19810 100 ug
EUR 403
Description: Rabbit polyclonal to EDEM2

EDEM2 Blocking Peptide

EUR 153

EDEM2 Blocking Peptide

DF9503-BP 1mg
EUR 195

Polyclonal EDEM2 Antibody

AMM07003G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human EDEM2 . This antibody is tested and proven to work in the following applications:

EDEM2 Conjugated Antibody

C46557 100ul
EUR 397

EDEM2 cloning plasmid

CSB-CL861146HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1737
  • Sequence: atgcctttccggctgctcatcccgctcggcctcctgtgcgcgctgctgcctcagcaccatggtgcgccaggtcccgacggctccgcgccagatcccgcccactacagggagcgagtcaaggccatgttctaccacgcctacgacagctacctggagaatgcctttcccttcgatg
  • Show more
Description: A cloning plasmid for the EDEM2 gene.

EDEM2 Polyclonal Antibody

A58890 100 µg
EUR 570.55
Description: kits suitable for this type of research

EDEM2 Polyclonal Antibody

ABP55756-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human EDEM2
  • Applications tips:
Description: A polyclonal antibody for detection of EDEM2 from Human. This EDEM2 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human EDEM2

EDEM2 Polyclonal Antibody

ABP55756-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human EDEM2
  • Applications tips:
Description: A polyclonal antibody for detection of EDEM2 from Human. This EDEM2 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human EDEM2

EDEM2 Polyclonal Antibody

ABP55756-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human EDEM2
  • Applications tips:
Description: A polyclonal antibody for detection of EDEM2 from Human. This EDEM2 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human EDEM2

EDEM2 Polyclonal Antibody

ES6755-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against EDEM2 from Human. This antibody is tested and validated for IHC, WB, ELISA

EDEM2 Polyclonal Antibody

ES6755-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against EDEM2 from Human. This antibody is tested and validated for IHC, WB, ELISA

anti- EDEM2 antibody

FNab02632 100µg
EUR 505.25
  • Immunogen: ER degradation enhancer, mannosidase alpha-like 2
  • Uniprot ID: Q9BV94
  • Gene ID: 55741
  • Research Area: Metabolism
Description: Antibody raised against EDEM2

Anti-EDEM2 antibody

PAab02632 100 ug
EUR 355

Anti-EDEM2 antibody

STJ92823 200 µl
EUR 197
Description: Rabbit polyclonal to EDEM2.

Anti-EDEM2 (2E4)

YF-MA11569 100 ug
EUR 363
Description: Mouse monoclonal to EDEM2

EDEM2 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EDEM2. Recognizes EDEM2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

EDEM2 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EDEM2. Recognizes EDEM2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

EDEM2 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EDEM2. Recognizes EDEM2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA


EF009290 96 Tests
EUR 689

Human EDEM2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


ELI-32317h 96 Tests
EUR 824

EDEM2 Recombinant Protein (Human)

RP010159 100 ug Ask for price

EDEM2 Recombinant Protein (Rat)

RP199049 100 ug Ask for price

EDEM2 Recombinant Protein (Mouse)

RP130856 100 ug Ask for price

EDEM2 Polyclonal Antibody, Biotin Conjugated

A58891 100 µg
EUR 570.55
Description: fast delivery possible

EDEM2 Polyclonal Antibody, FITC Conjugated

A58892 100 µg
EUR 570.55
Description: reagents widely cited

EDEM2 Polyclonal Antibody, HRP Conjugated

A58893 100 µg
EUR 570.55
Description: Ask the seller for details

Edem2 ORF Vector (Rat) (pORF)

ORF066351 1.0 ug DNA
EUR 506

EDEM2 ORF Vector (Human) (pORF)

ORF003387 1.0 ug DNA
EUR 95

Edem2 ORF Vector (Mouse) (pORF)

ORF043620 1.0 ug DNA
EUR 506

EDEM2 sgRNA CRISPR Lentivector set (Human)

K0653501 3 x 1.0 ug
EUR 339

Edem2 sgRNA CRISPR Lentivector set (Rat)

K7428201 3 x 1.0 ug
EUR 339

Edem2 sgRNA CRISPR Lentivector set (Mouse)

K3235601 3 x 1.0 ug
EUR 339

Monoclonal EDEM2 Antibody (clone 2E4), Clone: 2E4

AMM07004G 0.05mg
EUR 528
Description: A Monoclonal antibody against Human EDEM2 (clone 2E4). The antibodies are raised in Mouse and are from clone 2E4. This antibody is applicable in WB and IHC-P, E

EDEM2 sgRNA CRISPR Lentivector (Human) (Target 1)

K0653502 1.0 ug DNA
EUR 154

EDEM2 sgRNA CRISPR Lentivector (Human) (Target 2)

K0653503 1.0 ug DNA
EUR 154

EDEM2 sgRNA CRISPR Lentivector (Human) (Target 3)

K0653504 1.0 ug DNA
EUR 154

Edem2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7428202 1.0 ug DNA
EUR 154

Edem2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7428203 1.0 ug DNA
EUR 154

Edem2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7428204 1.0 ug DNA
EUR 154

Edem2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3235602 1.0 ug DNA
EUR 154

Edem2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3235603 1.0 ug DNA
EUR 154

Edem2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3235604 1.0 ug DNA
EUR 154

EDEM2 Protein Vector (Mouse) (pPB-C-His)

PV174478 500 ng
EUR 603

EDEM2 Protein Vector (Mouse) (pPB-N-His)

PV174479 500 ng
EUR 603

EDEM2 Protein Vector (Mouse) (pPM-C-HA)

PV174480 500 ng
EUR 603

EDEM2 Protein Vector (Mouse) (pPM-C-His)

PV174481 500 ng
EUR 603

EDEM2 Protein Vector (Rat) (pPB-C-His)

PV265402 500 ng
EUR 603

EDEM2 Protein Vector (Rat) (pPB-N-His)

PV265403 500 ng
EUR 603

EDEM2 Protein Vector (Rat) (pPM-C-HA)

PV265404 500 ng
EUR 603

EDEM2 Protein Vector (Rat) (pPM-C-His)

PV265405 500 ng
EUR 603

EDEM2 Protein Vector (Human) (pPB-C-His)

PV013545 500 ng
EUR 329

EDEM2 Protein Vector (Human) (pPB-N-His)

PV013546 500 ng
EUR 329

EDEM2 Protein Vector (Human) (pPM-C-HA)

PV013547 500 ng
EUR 329

EDEM2 Protein Vector (Human) (pPM-C-His)

PV013548 500 ng
EUR 329

Edem2 3'UTR GFP Stable Cell Line

TU155598 1.0 ml Ask for price

Edem2 3'UTR Luciferase Stable Cell Line

TU105598 1.0 ml Ask for price

Edem2 3'UTR Luciferase Stable Cell Line

TU203777 1.0 ml Ask for price

Edem2 3'UTR GFP Stable Cell Line

TU253777 1.0 ml Ask for price

EDEM2 3'UTR GFP Stable Cell Line

TU056560 1.0 ml
EUR 1394

EDEM2 3'UTR Luciferase Stable Cell Line

TU006560 1.0 ml
EUR 1394

EDEM2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV650983 1.0 ug DNA
EUR 682

EDEM2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV650987 1.0 ug DNA
EUR 682

EDEM2 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV650988 1.0 ug DNA
EUR 682

EDEM2 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV791509 1.0 ug DNA
EUR 316

EDEM2 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV791510 1.0 ug DNA
EUR 316

ER Degradation Enhancer, Mannosidase Alpha-Like 2 (EDEM2) Antibody

abx036086-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

ER Degradation Enhancer, Mannosidase alpha-Like 2 (EDEM2) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

ER Degradation Enhancer, Mannosidase Alpha-Like 2 (EDEM2) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

ER Degradation Enhancer, Mannosidase Alpha-Like 2 (EDEM2) Antibody

abx232632-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

ER Degradation Enhancer, Mannosidase Alpha-Like 2 (EDEM2) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

ER Degradation Enhancer, Mannosidase Alpha-Like 2 (EDEM2) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

ER Degradation Enhancer, Mannosidase Alpha-Like 2 (EDEM2) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

EDEM2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0653505 3 x 1.0 ug
EUR 376

Edem2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K7428205 3 x 1.0 ug
EUR 376

Edem2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3235605 3 x 1.0 ug
EUR 376

Human ER Degradation Enhancer, Mannosidase alpha-Like 2 (EDEM2) ELISA Kit

abx387046-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

EDEM2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K0653506 1.0 ug DNA
EUR 167

EDEM2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K0653507 1.0 ug DNA
EUR 167

EDEM2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K0653508 1.0 ug DNA
EUR 167

Edem2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K7428206 1.0 ug DNA
EUR 167

Edem2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K7428207 1.0 ug DNA
EUR 167

Edem2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K7428208 1.0 ug DNA
EUR 167

EDEM2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV650984 1.0 ug DNA
EUR 682

EDEM2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV650985 1.0 ug DNA
EUR 740

EDEM2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV650986 1.0 ug DNA
EUR 740

Edem2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K3235606 1.0 ug DNA
EUR 167

Edem2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K3235607 1.0 ug DNA
EUR 167

Edem2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K3235608 1.0 ug DNA
EUR 167

EDEM2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV791507 1.0 ug DNA
EUR 374

EDEM2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV791508 1.0 ug DNA
EUR 374

The prime dose was meant to be the very best dose producing scientific indicators or histopathological results with out inflicting mortality, i.e. the 28-day most tolerated dose. The liver Comet assay was carried out in accordance with revealed suggestions and following the protocol for the continuing JaCVAM validation trial. Laboratories supplied liver Comet assay knowledge obtained on the finish of the long-term (2- or 4-week) research along with an analysis of liver histology.

Most of the take a look at compounds had been additionally investigated within the liver Comet assay after short-term (1-Three each day) administration to match the sensitivity of the 2 research designs. MN analyses had been carried out in bone marrow or peripheral blood for many of the compounds to find out whether or not the liver Comet assay might complement the MN assay for the detection of genotoxins after long-term therapy.

Most of the liver genotoxins had been optimistic and the three non-genotoxic carcinogens gave unfavorable end result within the liver Comet assay after long-term administration. There was a excessive concordance between short- and long-term Comet assay outcomes. Most compounds when examined as much as the utmost tolerated dose had been accurately detected in each short- and long-term research.

Discrepant outcomes had been obtained with 2,6 diaminotoluene (unfavorable within the short-term, however optimistic within the long-term research), phenobarbital (optimistic within the short-term, however unfavorable within the long-term research) and gemifloxacin (optimistic within the short-term, however unfavorable within the long-term research).

The total outcomes point out that the liver Comet assay will be built-in inside repeat-dose toxicity research and effectively enhances the MN assay in detecting genotoxins. Practical elements of integrating genotoxicity endpoints into repeat-dose research had been evaluated, e.g. by investigating the impact of blood sampling, as usually carried out throughout toxicity research, on the Comet and MN assays.

The bleeding protocols used right here didn’t have an effect on the conclusions of the Comet assay or of the MN assays in blood and bone marrow. Although bleeding typically elevated reticulocyte frequencies, the sensitivity of the response within the MN assay was not altered. 

FLX pyrosequencing analysis of the effects of the brown-algal fermentable polysaccharides alginate and laminaran on rat cecal microbiotas.

FLX pyrosequencing analysis of the effects of the brown-algal fermentable polysaccharides alginate and laminaran on rat cecal microbiotas.

Edible brown algae are used as main meals materials in Far East Asian international locations, significantly in South Korea and Japan. They comprise fermentable dietary fibers, alginic acid (uronic acid polymer) and laminaran (β-1,3-glucan), which can be fermented into natural acids by intestinal micro organism.

To make clear the impact of edible algae on the intestinal setting, the cecal microbiotas of rats fed diets containing no dietary fiber (management) or 2% (wt/wt) sodium alginate or laminaran for two weeks have been analyzed utilizing FLX amplicon pyrosequencing with bar-coded primers focusing on the bacterial 16S rRNA gene. The most considerable phylum in all teams was Firmicutes.

Specifically, Allobaculum was dominant in all food regimen teams. In addition, Bacteroides capillosus (37.1%) was considerable in the alginate group, whereas Clostridium ramosum (3.14%) and Parabacteroides distasonis (1.36%) have been solely detected in the laminaran group. Furthermore, rats fed alginate confirmed simplified microbiota phylotypes in contrast with others. With respect to cecal chemical compounds, laminaran increased cecal natural acid ranges, significantly propionic acid. Alginate elevated complete cecal natural acids.

Cecal putrefactive compounds, comparable to indole, H(2)S, and phenol, have been decreased by each alginate and laminaran. These outcomes point out that edible brown algae can alter the intestinal setting, with fermentation by intestinal microbiota.

FLX pyrosequencing analysis of the effects of the brown-algal fermentable polysaccharides alginate and laminaran on rat cecal microbiotas.
FLX pyrosequencing analysis of the effects of the brown-algal fermentable polysaccharides alginate and laminaran on rat cecal microbiotas.

Tsunami lung.

We encountered three instances of lung issues attributable to drowning in the current massive tsunami that struck following the Great East Japan Earthquake. All three have been females, and two of them have been outdated aged. All segments of each lungs have been concerned in all the three sufferers, necessitating ICU admission and endotracheal intubation and mechanical air flow. All three died inside 3 weeks.

EDEM3 Antibody

45972-50ul 50ul
EUR 187

EDEM3 Antibody

DF9504 200ul
EUR 304
Description: EDEM3 Antibody detects endogenous levels of total EDEM3.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EDEM3 Antibody

ABD9504 100 ug
EUR 438

EDEM3 Blocking Peptide

EUR 153

EDEM3 Blocking Peptide

DF9504-BP 1mg
EUR 195

EDEM3 Polyclonal Antibody

ABP58454-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human EDEM3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of EDEM3 from Human, Mouse. This EDEM3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human EDEM3 protein

EDEM3 Polyclonal Antibody

ABP58454-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human EDEM3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of EDEM3 from Human, Mouse. This EDEM3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human EDEM3 protein

EDEM3 Polyclonal Antibody

ABP58454-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human EDEM3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of EDEM3 from Human, Mouse. This EDEM3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human EDEM3 protein

Polyclonal EDEM3 Antibody

AMM07005G 0.1mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human EDEM3 . This antibody is tested and proven to work in the following applications:

EDEM3 Conjugated Antibody

C45972 100ul
EUR 397

EDEM3 cloning plasmid

CSB-CL863170HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 369
  • Sequence: atgggaggctttaagtatggtgatgaacaaccacgttctgactggcgtagttatcgtaggaatctggagcatgctgtgttagaattgaccttgtttaaaactgtcccatcaaaaatggaaatccacagttcccccttcaaatgcagcactgcaccaccctgcaacacctcaggcca
  • Show more
Description: A cloning plasmid for the EDEM3 gene.

EDEM3 Polyclonal Antibody

ES9649-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against EDEM3 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

EDEM3 Polyclonal Antibody

ES9649-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against EDEM3 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

Anti-EDEM3 antibody

STJ190807 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to EDEM3

Mouse Edem3 ELISA KIT

ELI-26645m 96 Tests
EUR 865

Mouse EDEM3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human EDEM3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


ELI-47172h 96 Tests
EUR 824

Edem3 ORF Vector (Rat) (pORF)

ORF066352 1.0 ug DNA
EUR 506

EDEM3 ORF Vector (Human) (pORF)

ORF003388 1.0 ug DNA
EUR 95

Edem3 ORF Vector (Mouse) (pORF)

ORF043621 1.0 ug DNA
EUR 506

EDEM3 sgRNA CRISPR Lentivector set (Human)

K0653601 3 x 1.0 ug
EUR 339

Edem3 sgRNA CRISPR Lentivector set (Rat)

K6190401 3 x 1.0 ug
EUR 339

Edem3 sgRNA CRISPR Lentivector set (Mouse)

K3468201 3 x 1.0 ug
EUR 339

EDEM3 sgRNA CRISPR Lentivector (Human) (Target 1)

K0653602 1.0 ug DNA
EUR 154

EDEM3 sgRNA CRISPR Lentivector (Human) (Target 2)

K0653603 1.0 ug DNA
EUR 154

EDEM3 sgRNA CRISPR Lentivector (Human) (Target 3)

K0653604 1.0 ug DNA
EUR 154

Edem3 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6190402 1.0 ug DNA
EUR 154

Edem3 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6190403 1.0 ug DNA
EUR 154

Edem3 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6190404 1.0 ug DNA
EUR 154

Edem3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3468202 1.0 ug DNA
EUR 154

Edem3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3468203 1.0 ug DNA
EUR 154

Edem3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3468204 1.0 ug DNA
EUR 154

EDEM3 Protein Vector (Mouse) (pPB-C-His)

PV174482 500 ng
EUR 1065

EDEM3 Protein Vector (Mouse) (pPB-N-His)

PV174483 500 ng
EUR 1065

EDEM3 Protein Vector (Mouse) (pPM-C-HA)

PV174484 500 ng
EUR 1065

EDEM3 Protein Vector (Mouse) (pPM-C-His)

PV174485 500 ng
EUR 1065

EDEM3 Protein Vector (Rat) (pPB-C-His)

PV265406 500 ng
EUR 1166

EDEM3 Protein Vector (Rat) (pPB-N-His)

PV265407 500 ng
EUR 1166

EDEM3 Protein Vector (Rat) (pPM-C-HA)

PV265408 500 ng
EUR 1166

EDEM3 Protein Vector (Rat) (pPM-C-His)

PV265409 500 ng
EUR 1166

EDEM3 Protein Vector (Human) (pPB-C-His)

PV013549 500 ng
EUR 329

EDEM3 Protein Vector (Human) (pPB-N-His)

PV013550 500 ng
EUR 329

EDEM3 Protein Vector (Human) (pPM-C-HA)

PV013551 500 ng
EUR 329

EDEM3 Protein Vector (Human) (pPM-C-His)

PV013552 500 ng
EUR 329

Edem3 3'UTR GFP Stable Cell Line

TU155599 1.0 ml Ask for price

Edem3 3'UTR Luciferase Stable Cell Line

TU105599 1.0 ml Ask for price

Edem3 3'UTR Luciferase Stable Cell Line

TU203778 1.0 ml Ask for price

Edem3 3'UTR GFP Stable Cell Line

TU253778 1.0 ml Ask for price

EDEM3 3'UTR GFP Stable Cell Line

TU056561 1.0 ml
EUR 2333

EDEM3 3'UTR Luciferase Stable Cell Line

TU006561 1.0 ml
EUR 2333

ER Degradation-Enhancing Alpha-Mannosidase-Like Protein 3 (EDEM3) Antibody

  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

ER Degradation-Enhancing Alpha-Mannosidase-Like Protein 3 (EDEM3) Antibody

abx028901-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

ER Degradation-Enhancing Alpha-Mannosidase-Like Protein 3 (EDEM3) Antibody

abx028901-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

EDEM3 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0653605 3 x 1.0 ug
EUR 376

Edem3 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6190405 3 x 1.0 ug
EUR 376

Edem3 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3468205 3 x 1.0 ug
EUR 376

EDEM3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K0653606 1.0 ug DNA
EUR 167

EDEM3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K0653607 1.0 ug DNA
EUR 167

EDEM3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K0653608 1.0 ug DNA
EUR 167

Edem3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K6190406 1.0 ug DNA
EUR 167

Edem3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K6190407 1.0 ug DNA
EUR 167

Edem3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K6190408 1.0 ug DNA
EUR 167

Edem3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K3468206 1.0 ug DNA
EUR 167

Edem3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K3468207 1.0 ug DNA
EUR 167

Edem3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K3468208 1.0 ug DNA
EUR 167

In no less than two instances, misswallowing of oil was suspected from the options famous at the time of the detection. Sputum tradition for micro organism yielded isolation of Stenotrophomonas maltophilia, Legionella pneumophila, Burkholderia cepacia, and Pseudomonas aeruginosa. The trigger of tsunami lung could also be a mix of chemical induced pneumonia and bacterial pneumonia.

Cultivated oral mucosal epithelial transplantation for persistent epithelial defect in severe ocular surface diseases with acute inflammatory activity.

To assess the medical efficacy of cultivated oral mucosal epithelial transplantation (COMET) for the remedy of persistent epithelial defect (PED).
We handled 10 eyes of 9 sufferers with PED (Stevens-Johnson syndrome: three eyes; thermal/chemical harm: 5 eyes; ocular cicatricial pemphigoid: two eyes) with COMET at Kyoto Prefectural University of Medicine, Kyoto, Japan from 2002 to 2008.
Preoperatively, PED existed on over greater than 50% of the corneal surface in seven eyes. Severe ocular surface irritation with fibrovascular tissue surrounded the PED in all 10 eyes. At 24-weeks postoperative, PED had improved in all instances besides 1 in which the affected person was unable to return to the hospital (95% CI, 55.5-99.7; Wilcoxon signed-rank check, p = 0.0078).
The preoperative median of logarithmic minimal angle of decision was 1.85 (vary 0.15-2.70), and 1.85, 1.85, and 1.52 on the 4th, 12th, and 24th postoperative week, respectively.
The imply whole preoperative ocular surface grading rating was 7.0 (vary 4-17). At Four and 12 weeks postoperative, the whole ocular surface grading rating had improved considerably (p = 0.0020, p = 0.0078), and at 24 weeks postoperative, it was 3.0 (vary 2-12, p = 0.0234). During the follow-up interval (median 23.Three months, vary 5.6-39.7 months), no recurrence of PED was noticed in any eye, and long-term ocular surface stability was obtained.
COMET enabled full epithelialization of PED and stabilization of the ocular surface in sufferers with severe ocular surface illness, thus stopping end-stage cicatrization and imaginative and prescient loss at a later stage.
 Cultivated oral mucosal epithelial transplantation for persistent epithelial defect in severe ocular surface diseases with acute inflammatory activity.
Cultivated oral mucosal epithelial transplantation for persistent epithelial defect in severe ocular surface diseases with acute inflammatory exercise.

Antianxiety-like results of Chimpi (dried citrus peels) in the elevated open-platform check.

Dried citrus peels (Chimpi) is likely one of the most typical pure medicines with qi (power circulate) rectifying and shi (dampness) drying actions, which originates from Citrus unshiu, and/or C. reticulata in response to the definition of the pharmacopoeiae of Japan and China. In this examine, the pharmacological results of their extracts and main chemical constituents hesperidin and its aglycone hesperetin on nervousness had been examined with an nervousness mannequin of elevated open-platform check utilizing ICR male mice (6-week-old) and whole period of freezing was decreased in fluoxetine-treated mice, which is a straightforward and extremely delicate to the consequences of serotonergic anxiolytics.

EDTA disodium salt dihydrate

GE3023-1KG 1 kg
EUR 70

EDTA disodium salt dihydrate

GE3023-250G 250 g
EUR 46

EDTA disodium salt dihydrate

GE3023-500G 500 g
EUR 54

EDTA disodium salt dihydrate

GE3023-5KG 5 kg
EUR 150

EDTA, Disodium Salt, Dihydrate

CH032 500 g
EUR 163

EDTA, Disodium Salt, Dihydrate

CH033 1.0 kg
EUR 195

EDTA, disodium salt, dihydrate

EB0185 500g
EUR 70.01
  • Product category: Biochemicals/Misc. Biochemicals

EDTA disodium zinc salt hydrate

GX3802-100G 100 g
EUR 54

EDTA disodium zinc salt hydrate

GX3802-250G 250 g
EUR 75

EDTA disodium zinc salt hydrate

GX3802-25G 25 g
EUR 43

EDTA disodium zinc salt hydrate

GX3802-500G 500 g
EUR 110

EDTA manganese disodium salt hydrate

GX6009-100G 100 g
EUR 102

EDTA manganese disodium salt hydrate

GX6009-250G 250 g
EUR 174

EDTA manganese disodium salt hydrate

GX6009-25G 25 g
EUR 58

EDTA manganese disodium salt hydrate

GX6009-500G 500 g
EUR 269

EDTA magnesium disodium salt hydrate

GE3956-100G 100 g
EUR 66

EDTA magnesium disodium salt hydrate

GE3956-1KG 1 kg
EUR 245

EDTA magnesium disodium salt hydrate

GE3956-250G 250 g
EUR 102

EDTA magnesium disodium salt hydrate

GE3956-25G 25 g
EUR 45

EDTA magnesium disodium salt hydrate

GE3956-500G 500 g
EUR 154

EDTA copper(II) disodium salt

EB0434 250g
EUR 83.93
  • Product category: Biochemicals/Misc. Biochemicals

EDTA disodium and monomagnesium salt

EB0435 500g
EUR 110.9
  • Product category: Biochemicals/Misc. Biochemicals

EDTA zinc (II), disodium salt

EB6666 100g
EUR 64.79
  • Product category: Biochemicals/Misc. Biochemicals

EDTA disodium and monocalcium salt

EK014P2 500g
EUR 96.11
  • Product category: Biochemicals/Misc. Biochemicals

EDTA calcium disodium salt dihydrate, BP, Ph. Eur., USP grade

GE8581-1KG 1 kg
EUR 201

EDTA calcium disodium salt dihydrate, BP, Ph. Eur., USP grade

GE8581-250G 250 g
EUR 86

EDTA calcium disodium salt dihydrate, BP, Ph. Eur., USP grade

GE8581-500G 500 g
EUR 126

ATP disodium salt

B3304-5.1 10 mM (in 1mL H2O)
EUR 108
Description: ATP Disodium salt is a P2 purinoceptor agonist.

ATP disodium salt

B3304-50 50 mg
EUR 128
Description: ATP Disodium salt is a P2 purinoceptor agonist.

ATP disodium salt

B3304-S Evaluation Sample
EUR 81
Description: ATP Disodium salt is a P2 purinoceptor agonist.

NBQX disodium salt

B6566-10 10 mg
EUR 222

NBQX disodium salt

B6566-25 25 mg
EUR 389

NBQX disodium salt

B6566-5 5 mg
EUR 139

NBQX disodium salt

B6566-50 50 mg
EUR 683

CNQX disodium salt

B6567-1 1 mg
EUR 134

CNQX disodium salt

B6567-10 10 mg
EUR 215

CNQX disodium salt

B6567-50 50 mg
EUR 746

Hypoxanthine Disodium Salt

EUR 109

Hypoxanthine Disodium Salt

EUR 240

Phosphoramidon Disodium Salt

B4790-25 25 mg
EUR 490
Description: Phosphoramidon Disodium Salt is a potent inhibitor of metalloproteinase [1]. Metalloproteinase is an enzyme whose catalytic mechanism involves a metal. Most metalloproteases require zinc and some require cobalt.

Phosphoramidon Disodium Salt

B4790-5 5 mg
EUR 189
Description: Phosphoramidon Disodium Salt is a potent inhibitor of metalloproteinase [1]. Metalloproteinase is an enzyme whose catalytic mechanism involves a metal. Most metalloproteases require zinc and some require cobalt.

DNQX disodium salt

B5288-100 100 mg
EUR 279

DNQX disodium salt

B5288-25 25 mg
EUR 128

DNQX disodium salt

B5288-50 50 mg
EUR 186

UDP disodium salt

B7278-5.1 10 mM (in 1mL DMSO)
EUR 108

UDP disodium salt

B7278-50 50 mg
EUR 125

Phosphocreatine disodium salt

B7648-25 25 mg
EUR 196

Methoxatin (disodium salt)

HY-100196A 10mM/1mL
EUR 186

ATP (disodium salt)

HY-B0345A 10mM/1mL
EUR 113

NADH (disodium salt)

HY-F0001 10mM/1mL
EUR 113

NADP (disodium salt)

HY-F0002A 500mg
EUR 271

Balsalazide disodium salt

GP7647-1G 1 g
EUR 110

cGAMP disodium salt

GL2101-100UG 100 ug
EUR 160

cGAMP disodium salt

GL2101-500UG 500 ug
EUR 332

Etidronate disodium salt

GP3560-1G 1 g
EUR 174

Lobenzarit disodium salt

GP3753-100MG 100 mg
EUR 229

Carbenicillin disodium salt

GA1299-10G 10 g
EUR 229

Carbenicillin disodium salt

GA1299-1G 1 g
EUR 86

Carbenicillin disodium salt

GA1299-250MG 250 mg
EUR 59

Carbenicillin disodium salt

GA1299-25G 25 g
EUR 341

Carbenicillin disodium salt

GA1299-5G 5 g
EUR 158

Ticarcillin disodium salt

GA1874-100MG 100 mg
EUR 50

Ticarcillin disodium salt

GA1874-1G 1 g
EUR 110

Ticarcillin disodium salt

GA1874-500MG 500 mg
EUR 78

Cefotetan disodium salt

GA5476-100MG 100 mg
EUR 86

Cefotetan disodium salt

GA5476-1G 1 g
EUR 181

Phosphomycin disodium salt

GA7173-1G 1 g
EUR 70

Phosphomycin disodium salt

GA7173-25G 25 g
EUR 289

Phosphomycin disodium salt

GA7173-5G 5 g
EUR 134

ADA disodium salt

GB0256-100G 100 g
EUR 110

ADA disodium salt

GB0256-500G 500 g
EUR 341

PIPES disodium salt

GB1799-100G 100 g
EUR 110

PIPES disodium salt

GB1799-250G 250 g
EUR 181

PIPES disodium salt

GB1799-25G 25 g
EUR 70

PIPES disodium salt

GB1799-500G 500 g
EUR 309

POPSO disodium salt

GB6170-100G 100 g
EUR 269

POPSO disodium salt

GB6170-25G 25 g
EUR 126

Carbenicillin, Disodium Salt

A2511-5.1 10 mM (in 1mL DMSO)
EUR 108
Description: Carbenicillin inhibits the cell-wall synthesis (peptidoglycan cross-linking) by inactivating transpeptidase on the inner surface of the bacterial cell membrane.Carbenicillin is a white to slightly yellow, hygroscopic powder soluble in water and in alcohol.

Carbenicillin, Disodium Salt

A2511-50 50 mg
EUR 131
Description: Carbenicillin inhibits the cell-wall synthesis (peptidoglycan cross-linking) by inactivating transpeptidase on the inner surface of the bacterial cell membrane.Carbenicillin is a white to slightly yellow, hygroscopic powder soluble in water and in alcohol.

cGAMP disodium salt

EUR 196

NADH, disodium salt

EUR 169

NADH, disodium salt

EUR 142

NADH, disodium salt

EUR 544

NADP, disodium salt

EUR 153

NADP, disodium salt

EUR 784

NADP, disodium salt

EUR 457

NBQX disodium salt

EUR 642

NBQX disodium salt

EUR 207

BCA disodium salt

EUR 865

BCA disodium salt

EUR 120

BCA disodium salt

EUR 2605

BCA disodium salt

EUR 218

POPSO, disodium salt

PB4959 25g
EUR 76.97
  • Product category: Biochemicals/Biological Buffers/Common Buffers

BCIP disodium salt

BB1171 500mg
EUR 232.7
  • Product category: Biochemicals/Indicators/Stains/DNA/RNA/Protein Related

Dimethylglyoxime disodium salt

DD1221 100g
EUR 63.92
  • Product category: Biochemicals/Misc. Biochemicals

Fluorescein, disodium salt

FB0203 100g
EUR 63.92
  • Product category: Biochemicals/Indicators/Stains/Other

EDTA tripotassium salt dihydrate

GL1464-100G 100 g
EUR 61

EDTA tripotassium salt dihydrate

GL1464-250G 250 g
EUR 86

EDTA tripotassium salt dihydrate

GL1464-25G 25 g
EUR 44

EDTA tripotassium salt dihydrate

GL1464-500G 500 g
EUR 128

EDTA tetrasodium salt hydrate

GE3450-100G 100 g
EUR 41

EDTA tetrasodium salt hydrate

GE3450-1KG 1 kg
EUR 68

EDTA tetrasodium salt hydrate

GE3450-250G 250 g
EUR 45

EDTA tetrasodium salt hydrate

GE3450-500G 500 g
EUR 53

EDTA tetrasodium salt hydrate

GE3450-5KG 5 kg
EUR 166

EDTA dipotassium salt dihydrate

GE5635-100G 100 g
EUR 54

EDTA dipotassium salt dihydrate

GE5635-250G 250 g
EUR 74

EDTA dipotassium salt dihydrate

GE5635-500G 500 g
EUR 102

EDTA ferric sodium salt

GE7700-100G 100 g
EUR 44

EDTA ferric sodium salt

GE7700-1KG 1 kg
EUR 98

EDTA ferric sodium salt

GE7700-250G 250 g
EUR 54

EDTA ferric sodium salt

GE7700-500G 500 g
EUR 70

EDTA trisodium salt dihydrate

GE9701-100G 100 g
EUR 54

EDTA trisodium salt dihydrate

GE9701-250G 250 g
EUR 78

EDTA trisodium salt dihydrate

GE9701-500G 500 g
EUR 118

EDTA tetrasodium salt dihydrate

GK0795-100G 100 g
EUR 40

EDTA tetrasodium salt dihydrate

GK0795-1KG 1 kg
EUR 70

EDTA tetrasodium salt dihydrate

GK0795-2500G 2500 g
EUR 118

EDTA tetrasodium salt dihydrate

GK0795-250G 250 g
EUR 46

EDTA tetrasodium salt dihydrate

GK0795-500G 500 g
EUR 53

EDTA, tetrasodium salt dihydrate

EB0436 500g
EUR 88.28
  • Product category: Biochemicals/Misc. Biochemicals

EDTA, dipotassium salt, dihydrate

ED0075 250g
EUR 83.06
  • Product category: Biochemicals/Misc. Biochemicals

CL 316243 disodium salt

B6766-1 1 mg
EUR 109
Description: EC50: (3.0±0.3) X 10-8 M for ?3 adrenoceptor [1].Benzodioxole-containing phenethanolamine CL-316,243 is a murine-selective ?3 adrenoceptor agonist which can correct obesity and elevated blood glucose in diabetic rodents.

CL 316243 disodium salt

B6766-10 10 mg
EUR 293
Description: EC50: (3.0±0.3) X 10-8 M for ?3 adrenoceptor [1].Benzodioxole-containing phenethanolamine CL-316,243 is a murine-selective ?3 adrenoceptor agonist which can correct obesity and elevated blood glucose in diabetic rodents.

CL 316243 disodium salt

B6766-5 5 mg
EUR 206
Description: EC50: (3.0±0.3) X 10-8 M for ?3 adrenoceptor [1].Benzodioxole-containing phenethanolamine CL-316,243 is a murine-selective ?3 adrenoceptor agonist which can correct obesity and elevated blood glucose in diabetic rodents.

(RS)-MCPG disodium salt

B7476-10 10 mg
EUR 302

(RS)-MCPG disodium salt

B7476-50 50 mg
EUR 1114

Pamoic acid disodium salt

B7638-10 10 mg
EUR 480

Pamoic acid disodium salt

B7638-50 50 mg
EUR 1861

UDP-GlcNAc Disodium Salt

HY-112174 5mg
EUR 165

Bathocuproinedisulfonic acid disodium salt

GT0734-100MG 100 mg
EUR 50

Bathocuproinedisulfonic acid disodium salt

GT0734-1G 1 g
EUR 110

Bathocuproinedisulfonic acid disodium salt

GT0734-250MG 250 mg
EUR 62

Bathocuproinedisulfonic acid disodium salt

GT0734-500MG 500 mg
EUR 80

Pamoic acid disodium salt

GK6564-100G 100 g
EUR 86

Pamoic acid disodium salt

GK6564-250G 250 g
EUR 142

Pamoic acid disodium salt

GK6564-25G 25 g
EUR 54

Sulfobromophthalein disodium salt hydrate

GK6995-25G 25 g
EUR 245

Sulfobromophthalein disodium salt hydrate

GK6995-5G 5 g
EUR 110

Clodronate disodium salt hydrate

GP6103-1G 1 g
EUR 86

MUP, disodium salt, trihydrate

M0740 1g
EUR 93.5
  • Product category: Biochemicals/Indicators/Stains/Other

ADA buffer, disodium salt

AB0005 25g
EUR 66.53
  • Product category: Biochemicals/Biological Buffers/Common Buffers

EDTA, Iron (III), sodium salt

EB0437 100g
EUR 65.66
  • Product category: Biochemicals/Misc. Biochemicals

MUP, disodium salt [4-Methylumbelliferyl phosphate, disodium salt] *CAS 22919-26-2*

11610 25 mg
EUR 115
  • R-phrase: R20, R21, R22
  • H-Phrase: H303, H313, H333
  • Symbol for dangerous compounds: Xn
  • UNSPEC Code: 12171501

MUP, disodium salt [4-Methylumbelliferyl phosphate, disodium salt] *CAS 22919-26-2*

11612 10 g
EUR 898
  • R-phrase: R20, R21, R22
  • H-Phrase: H303, H313, H333
  • Symbol for dangerous compounds: Xn
  • UNSPEC Code: 12171501

L-?-Hydroxyglutaric Acid Disodium Salt

EUR 349

L-?-Hydroxyglutaric Acid Disodium Salt

EUR 131

Guanosine 5'-diphosphate disodium salt

HY-113066A 10mg
EUR 119

Glycerophosphoric acid (disodium salt hydrate)

HY-126304 100mg
EUR 108

Oleanolic acid hemiphthalate disodium salt

HY-128695 10mM/1mL
EUR 625

Cytidine-5’-triphosphate disodium salt

GP9015-100MG 100 mg
EUR 94

Cytidine-5’-triphosphate disodium salt

GP9015-1G 1 g
EUR 309

Cytidine-5’-triphosphate disodium salt

GP9015-500MG 500 mg
EUR 190

Hydroxy naphthol blue disodium salt

GT4927-100G 100 g
EUR 102

Hydroxy naphthol blue disodium salt

GT4927-25G 25 g
EUR 62

DL-Malic acid disodium salt

GX1468-100G 100 g
EUR 46

DL-Malic acid disodium salt

GX1468-500G 500 g
EUR 75

Bicinchoninic acid disodium salt hydrate

GK3616-10G 10 g
EUR 134

Bicinchoninic acid disodium salt hydrate

GK3616-1G 1 g
EUR 54

Bicinchoninic acid disodium salt hydrate

GK3616-25G 25 g
EUR 240

Bicinchoninic acid disodium salt hydrate

GK3616-5G 5 g
EUR 90

Succinic acid disodium salt, anhydrous

GK7702-100G 100 g
EUR 43

Succinic acid disodium salt, anhydrous

GK7702-1KG 1 kg
EUR 94

Succinic acid disodium salt, anhydrous

GK7702-250G 250 g
EUR 52

Succinic acid disodium salt, anhydrous

GK7702-500G 500 g
EUR 66

Succinic acid disodium salt, anhydrous

GK7702-5KG 5 kg
EUR 245

Dexamethasone 21-phosphate disodium salt

GL6086-1G 1 g
EUR 110

Dexamethasone 21-phosphate disodium salt

GL6086-5G 5 g
EUR 269

Xanthosine 5'-monophosphate disodium salt

GN2077-100MG 100 mg
EUR 229

Xanthosine 5'-monophosphate disodium salt

GN2077-25MG 25 mg
EUR 94

Adenosine 5'-monophosphate disodium salt

GN7778-10G 10 g
EUR 82

Adenosine 5'-monophosphate disodium salt

GN7778-1G 1 g
EUR 50

Adenosine 5'-monophosphate disodium salt

GN7778-25G 25 g
EUR 126

Adenosine 5'-monophosphate disodium salt

GN7778-5G 5 g
EUR 62

Guanosine-5'-triphosphate disodium salt

GE2026-1G 1 g
EUR 229

Guanosine 5'-diphosphate disodium salt

GE3702-100MG 100 mg
EUR 118

Guanosine 5'-diphosphate disodium salt

GE3702-250MG 250 mg
EUR 174

Adenosine 5'-diphosphate disodium salt

GE3988-1G 1 g
EUR 78

Adenosine 5'-diphosphate disodium salt

GE3988-250MG 250 mg
EUR 50

L-Tyrosine disodium salt hydrate

GE4061-100G 100 g
EUR 84

L-Tyrosine disodium salt hydrate

GE4061-25G 25 g
EUR 48

L-Tyrosine disodium salt hydrate

GE4061-50G 50 g
EUR 61

Uridine 5'-monophosphate disodium salt

GE7138-100G 100 g
EUR 269

Uridine 5'-monophosphate disodium salt

GE7138-25G 25 g
EUR 110

Uridine 5'-monophosphate disodium salt

GE7138-5G 5 g
EUR 62

Creatine phosphate disodium salt hydrate

GE7721-100G 100 g
EUR 333

Creatine phosphate disodium salt hydrate

GE7721-25G 25 g
EUR 150

Creatine phosphate disodium salt hydrate

GE7721-5G 5 g
EUR 74

Ceftriaxone disodium salt hemi(heptahydrate)

GA6812-1G 1 g
EUR 62

Ceftriaxone disodium salt hemi(heptahydrate)

GA6812-25G 25 g
EUR 229

Moreover, yokukansankachimpihange (YKH), a mix of yokukansan with Chimpi and Hange (Pinellia) was additionally examined as a result of Chimpi is taken into account to play an important half in this formulation in opposition to anxious signs in dementia sufferers.

The outcomes confirmed that Chimpi and YKH possess a major anxiolytic-like impact much like that of fluoxetine, suggesting that they could be much like fluoxetine in their pharmacological actions by way of the serotonergic neurotransmission pathway.

Moreover, it additionally advised that the main chemical constituent, hesperidin may very well be an lively precept attributed to the antianxiety-like results with a direct and oblique position through its aglycone hesperetin.