Histopathological examination of newly-developed adhesive silicone denture relining material.

Histopathological examination of newly-developed adhesive silicone denture relining material.

We aimed to guage the subcutaneous tissue response to a newly developed adhesive silicone denture relining materials, SG, (Neo Dental Chemical Products Co., Ltd. Tokyo, Japan). We embedded the experimental materials SG and one other present management materials, Roeko Seal (RS), within the dorsal space of 22 male ddY mice.

One week and 12 weeks after the embedding, the tissues surrounding the embedded supplies had been eliminated and a histopathological examination was carried out. The outcomes reveal that the essential histopathological elements are the formation of granulation tissue and the change of the tissue to fibrous capsule over time.

The outcomes means that the newly-developed SG is secure as in contrast with the management RS, whose composition is comparable.

Histopathological examination of newly-developed adhesive silicone denture relining material.
Histopathological examination of newly-developed adhesive silicone denture relining materials.

Collaborative research on fifteen compounds within the rat-liver Comet assay built-in into 2- and 4-week repeat-dose research.

A collaborative trial was carried out to guage the likelihood of integrating the rat-liver Comet assay into repeat-dose toxicity research. Fourteen laboratories from Europe, Japan and the USA examined fifteen chemical compounds.

Two chemical compounds had been beforehand proven to induce micronuclei in an acute protocol, however had been discovered unfavorable in a 4-week Micronucleus (MN) Assay (benzo[a]pyrene and 1,2-dimethylhydrazine; Hamada et al., 2001); 4 genotoxic rat-liver carcinogens that had been unfavorable within the MN assay in bone marrow or blood (2,6-dinitrotoluene, dimethylnitrosamine, 1,2-dibromomethane, and 2-amino-3-methylimidazo[4,5-f]quinoline); three compounds used within the ongoing JaCVAM (Japanese Center for the Validation of Alternative Methods) validation research of the acute liver Comet assay (2,4-diaminotoluene, 2,6-diaminotoluene and acrylamide); three pharmaceutical-like compounds (chlordiazepoxide, pyrimethamine and gemifloxacin), and three non-genotoxic rodent liver carcinogens (methapyrilene, clofibrate and phenobarbital). Male rats obtained oral administrations of the take a look at compounds, each day for 2 or 4 weeks.

EDEM2 Antibody

40055-100ul 100ul
EUR 390.00

EDEM2 Antibody

46557-100ul 100ul
EUR 252.00

EDEM2 Antibody

ABD9503 100 ug
EUR 438.00

EDEM2 Antibody

1-CSB-PA861146LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EDEM2. Recognizes EDEM2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

EDEM2 Antibody

6633-100
EUR 349.00

EDEM2 Antibody

6633-30T
EUR 146.00

EDEM2 Antibody

1-CSB-PA030228
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against EDEM2. Recognizes EDEM2 from Human. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/10000

pOTB7-EDEM2

PVT18710 2 ug
EUR 231.00

anti-EDEM2

YF-PA19809 50 ul
EUR 363.00
Description: Mouse polyclonal to EDEM2

anti-EDEM2

YF-PA19810 100 ug
EUR 403.00
Description: Rabbit polyclonal to EDEM2

EDEM2 Antibody

DF9503 200ul
EUR 304.00
Description: EDEM2 Antibody detects endogenous levels of total EDEM2.

EDEM2 Polyclonal Antibody

ABP55756-003ml 0.03ml
EUR 158.00
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human EDEM2
  • Applications tips:
Description: A polyclonal antibody for detection of EDEM2 from Human. This EDEM2 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human EDEM2

EDEM2 Polyclonal Antibody

ABP55756-01ml 0.1ml
EUR 289.00
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human EDEM2
  • Applications tips:
Description: A polyclonal antibody for detection of EDEM2 from Human. This EDEM2 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human EDEM2

EDEM2 Polyclonal Antibody

ABP55756-02ml 0.2ml
EUR 414.00
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human EDEM2
  • Applications tips:
Description: A polyclonal antibody for detection of EDEM2 from Human. This EDEM2 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human EDEM2

EDEM2 Polyclonal Antibody

A58890 100 µg
EUR 570.55
Description: kits suitable for this type of research

EDEM2 Polyclonal Antibody

ES6755-100ul 100ul
EUR 279.00
Description: A Rabbit Polyclonal antibody against EDEM2 from Human. This antibody is tested and validated for IHC, WB, ELISA

EDEM2 Polyclonal Antibody

ES6755-50ul 50ul
EUR 207.00
Description: A Rabbit Polyclonal antibody against EDEM2 from Human. This antibody is tested and validated for IHC, WB, ELISA

EDEM2 Conjugated Antibody

C46557 100ul
EUR 397.00

EDEM2 Blocking Peptide

6633BP-50
EUR 153.00

EDEM2 cloning plasmid

CSB-CL861146HU-10ug 10ug
EUR 376.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1737
  • Sequence: atgcctttccggctgctcatcccgctcggcctcctgtgcgcgctgctgcctcagcaccatggtgcgccaggtcccgacggctccgcgccagatcccgcccactacagggagcgagtcaaggccatgttctaccacgcctacgacagctacctggagaatgcctttcccttcgatg
  • Show more
Description: A cloning plasmid for the EDEM2 gene.

Anti-EDEM2 (2E4)

YF-MA11569 100 ug
EUR 363.00
Description: Mouse monoclonal to EDEM2

Anti-EDEM2 antibody

PAab02632 100 ug
EUR 355.00

EDEM2 Blocking Peptide

DF9503-BP 1mg
EUR 195.00

anti- EDEM2 antibody

FNab02632 100µg
EUR 505.25
  • Immunogen: ER degradation enhancer, mannosidase alpha-like 2
  • Uniprot ID: Q9BV94
  • Gene ID: 55741
  • Research Area: Metabolism
Description: Antibody raised against EDEM2

Polyclonal EDEM2 Antibody

AMM07003G 0.1mg
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human EDEM2 . This antibody is tested and proven to work in the following applications:

Anti-EDEM2 antibody

STJ92823 200 µl
EUR 197.00
Description: Rabbit polyclonal to EDEM2.

EDEM2 Antibody, HRP conjugated

1-CSB-PA861146LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EDEM2. Recognizes EDEM2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

EDEM2 Antibody, FITC conjugated

1-CSB-PA861146LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EDEM2. Recognizes EDEM2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

EDEM2 Antibody, Biotin conjugated

1-CSB-PA861146LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EDEM2. Recognizes EDEM2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human EDEM2 ELISA KIT

ELI-32317h 96 Tests
EUR 824.00

EDEM2 ELISA KIT|Human

EF009290 96 Tests
EUR 689.00

Human EDEM2 shRNA Plasmid

20-abx960878
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

EDEM2 Recombinant Protein (Human)

RP010159 100 ug Ask for price

EDEM2 Recombinant Protein (Mouse)

RP130856 100 ug Ask for price

EDEM2 Recombinant Protein (Rat)

RP199049 100 ug Ask for price

EDEM2 Polyclonal Antibody, Biotin Conjugated

A58891 100 µg
EUR 570.55
Description: fast delivery possible

EDEM2 Polyclonal Antibody, FITC Conjugated

A58892 100 µg
EUR 570.55
Description: reagents widely cited

EDEM2 Polyclonal Antibody, HRP Conjugated

A58893 100 µg
EUR 570.55
Description: Ask the seller for details

EDEM2 ORF Vector (Human) (pORF)

ORF003387 1.0 ug DNA
EUR 95.00

Edem2 ORF Vector (Rat) (pORF)

ORF066351 1.0 ug DNA
EUR 506.00

Edem2 ORF Vector (Mouse) (pORF)

ORF043620 1.0 ug DNA
EUR 506.00

Edem2 sgRNA CRISPR Lentivector set (Mouse)

K3235601 3 x 1.0 ug
EUR 339.00

Edem2 sgRNA CRISPR Lentivector set (Rat)

K7428201 3 x 1.0 ug
EUR 339.00

EDEM2 sgRNA CRISPR Lentivector set (Human)

K0653501 3 x 1.0 ug
EUR 339.00

Edem2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3235602 1.0 ug DNA
EUR 154.00

Edem2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3235603 1.0 ug DNA
EUR 154.00

Edem2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3235604 1.0 ug DNA
EUR 154.00

Edem2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7428202 1.0 ug DNA
EUR 154.00

Edem2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7428203 1.0 ug DNA
EUR 154.00

Edem2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7428204 1.0 ug DNA
EUR 154.00

EDEM2 sgRNA CRISPR Lentivector (Human) (Target 1)

K0653502 1.0 ug DNA
EUR 154.00

EDEM2 sgRNA CRISPR Lentivector (Human) (Target 2)

K0653503 1.0 ug DNA
EUR 154.00

EDEM2 sgRNA CRISPR Lentivector (Human) (Target 3)

K0653504 1.0 ug DNA
EUR 154.00

EDEM2 Protein Vector (Rat) (pPB-C-His)

PV265402 500 ng
EUR 603.00

EDEM2 Protein Vector (Rat) (pPB-N-His)

PV265403 500 ng
EUR 603.00

EDEM2 Protein Vector (Rat) (pPM-C-HA)

PV265404 500 ng
EUR 603.00

EDEM2 Protein Vector (Rat) (pPM-C-His)

PV265405 500 ng
EUR 603.00

EDEM2 3'UTR Luciferase Stable Cell Line

TU006560 1.0 ml
EUR 1394.00

EDEM2 3'UTR GFP Stable Cell Line

TU056560 1.0 ml
EUR 1394.00

EDEM2 Protein Vector (Mouse) (pPB-C-His)

PV174478 500 ng
EUR 603.00

EDEM2 Protein Vector (Mouse) (pPB-N-His)

PV174479 500 ng
EUR 603.00

EDEM2 Protein Vector (Mouse) (pPM-C-HA)

PV174480 500 ng
EUR 603.00

EDEM2 Protein Vector (Mouse) (pPM-C-His)

PV174481 500 ng
EUR 603.00

Edem2 3'UTR GFP Stable Cell Line

TU155598 1.0 ml Ask for price

Edem2 3'UTR GFP Stable Cell Line

TU253777 1.0 ml Ask for price

Edem2 3'UTR Luciferase Stable Cell Line

TU203777 1.0 ml Ask for price

Edem2 3'UTR Luciferase Stable Cell Line

TU105598 1.0 ml Ask for price

EDEM2 Protein Vector (Human) (pPB-C-His)

PV013545 500 ng
EUR 329.00

EDEM2 Protein Vector (Human) (pPB-N-His)

PV013546 500 ng
EUR 329.00

EDEM2 Protein Vector (Human) (pPM-C-HA)

PV013547 500 ng
EUR 329.00

EDEM2 Protein Vector (Human) (pPM-C-His)

PV013548 500 ng
EUR 329.00

Monoclonal EDEM2 Antibody (clone 2E4), Clone: 2E4

AMM07004G 0.05mg
EUR 528.00
Description: A Monoclonal antibody against Human EDEM2 (clone 2E4). The antibodies are raised in Mouse and are from clone 2E4. This antibody is applicable in WB and IHC-P, E

EDEM2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV650983 1.0 ug DNA
EUR 682.00

EDEM2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV650987 1.0 ug DNA
EUR 682.00

EDEM2 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV650988 1.0 ug DNA
EUR 682.00

EDEM2 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV791509 1.0 ug DNA
EUR 316.00

EDEM2 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV791510 1.0 ug DNA
EUR 316.00

ER Degradation Enhancer, Mannosidase Alpha-Like 2 (EDEM2) Antibody

abx232632-100ug 100 ug
EUR 481.00
  • Shipped within 5-12 working days.

ER Degradation Enhancer, Mannosidase Alpha-Like 2 (EDEM2) Antibody

abx036086-100ug 100 ug
EUR 391.00
  • Shipped within 5-10 working days.

ER Degradation Enhancer, Mannosidase alpha-Like 2 (EDEM2) Antibody

20-abx322885
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

ER Degradation Enhancer, Mannosidase Alpha-Like 2 (EDEM2) Antibody

20-abx310614
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

ER Degradation Enhancer, Mannosidase Alpha-Like 2 (EDEM2) Antibody (HRP)

20-abx310615
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

ER Degradation Enhancer, Mannosidase Alpha-Like 2 (EDEM2) Antibody (FITC)

20-abx310616
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

ER Degradation Enhancer, Mannosidase Alpha-Like 2 (EDEM2) Antibody (Biotin)

20-abx310617
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Edem2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3235605 3 x 1.0 ug
EUR 376.00

Edem2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K7428205 3 x 1.0 ug
EUR 376.00

EDEM2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0653505 3 x 1.0 ug
EUR 376.00

Human ER Degradation Enhancer, Mannosidase alpha-Like 2 (EDEM2) ELISA Kit

abx387046-96tests 96 tests
EUR 911.00
  • Shipped within 5-12 working days.

Edem2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K3235606 1.0 ug DNA
EUR 167.00

Edem2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K3235607 1.0 ug DNA
EUR 167.00

Edem2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K3235608 1.0 ug DNA
EUR 167.00

Edem2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K7428206 1.0 ug DNA
EUR 167.00

Edem2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K7428207 1.0 ug DNA
EUR 167.00

Edem2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K7428208 1.0 ug DNA
EUR 167.00

EDEM2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K0653506 1.0 ug DNA
EUR 167.00

EDEM2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K0653507 1.0 ug DNA
EUR 167.00

EDEM2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K0653508 1.0 ug DNA
EUR 167.00

EDEM2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV650984 1.0 ug DNA
EUR 682.00

EDEM2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV650985 1.0 ug DNA
EUR 740.00

EDEM2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV650986 1.0 ug DNA
EUR 740.00

EDEM2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV791507 1.0 ug DNA
EUR 374.00

EDEM2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV791508 1.0 ug DNA
EUR 374.00

The prime dose was meant to be the very best dose producing scientific indicators or histopathological results with out inflicting mortality, i.e. the 28-day most tolerated dose. The liver Comet assay was carried out in accordance with revealed suggestions and following the protocol for the continuing JaCVAM validation trial. Laboratories supplied liver Comet assay knowledge obtained on the finish of the long-term (2- or 4-week) research along with an analysis of liver histology.

Most of the take a look at compounds had been additionally investigated within the liver Comet assay after short-term (1-Three each day) administration to match the sensitivity of the 2 research designs. MN analyses had been carried out in bone marrow or peripheral blood for many of the compounds to find out whether or not the liver Comet assay might complement the MN assay for the detection of genotoxins after long-term therapy.

Most of the liver genotoxins had been optimistic and the three non-genotoxic carcinogens gave unfavorable end result within the liver Comet assay after long-term administration. There was a excessive concordance between short- and long-term Comet assay outcomes. Most compounds when examined as much as the utmost tolerated dose had been accurately detected in each short- and long-term research.

Discrepant outcomes had been obtained with 2,6 diaminotoluene (unfavorable within the short-term, however optimistic within the long-term research), phenobarbital (optimistic within the short-term, however unfavorable within the long-term research) and gemifloxacin (optimistic within the short-term, however unfavorable within the long-term research).

The total outcomes point out that the liver Comet assay will be built-in inside repeat-dose toxicity research and effectively enhances the MN assay in detecting genotoxins. Practical elements of integrating genotoxicity endpoints into repeat-dose research had been evaluated, e.g. by investigating the impact of blood sampling, as usually carried out throughout toxicity research, on the Comet and MN assays.

The bleeding protocols used right here didn’t have an effect on the conclusions of the Comet assay or of the MN assays in blood and bone marrow. Although bleeding typically elevated reticulocyte frequencies, the sensitivity of the response within the MN assay was not altered. 

Cultivated oral mucosal epithelial transplantation for persistent epithelial defect in severe ocular surface diseases with acute inflammatory activity.

OBJECTIVE
To assess the medical efficacy of cultivated oral mucosal epithelial transplantation (COMET) for the remedy of persistent epithelial defect (PED).
METHODS
We handled 10 eyes of 9 sufferers with PED (Stevens-Johnson syndrome: three eyes; thermal/chemical harm: 5 eyes; ocular cicatricial pemphigoid: two eyes) with COMET at Kyoto Prefectural University of Medicine, Kyoto, Japan from 2002 to 2008.
RESULTS
Preoperatively, PED existed on over greater than 50% of the corneal surface in seven eyes. Severe ocular surface irritation with fibrovascular tissue surrounded the PED in all 10 eyes. At 24-weeks postoperative, PED had improved in all instances besides 1 in which the affected person was unable to return to the hospital (95% CI, 55.5-99.7; Wilcoxon signed-rank check, p = 0.0078).
The preoperative median of logarithmic minimal angle of decision was 1.85 (vary 0.15-2.70), and 1.85, 1.85, and 1.52 on the 4th, 12th, and 24th postoperative week, respectively.
The imply whole preoperative ocular surface grading rating was 7.0 (vary 4-17). At Four and 12 weeks postoperative, the whole ocular surface grading rating had improved considerably (p = 0.0020, p = 0.0078), and at 24 weeks postoperative, it was 3.0 (vary 2-12, p = 0.0234). During the follow-up interval (median 23.Three months, vary 5.6-39.7 months), no recurrence of PED was noticed in any eye, and long-term ocular surface stability was obtained.
CONCLUSIONS
COMET enabled full epithelialization of PED and stabilization of the ocular surface in sufferers with severe ocular surface illness, thus stopping end-stage cicatrization and imaginative and prescient loss at a later stage.
 Cultivated oral mucosal epithelial transplantation for persistent epithelial defect in severe ocular surface diseases with acute inflammatory activity.
Cultivated oral mucosal epithelial transplantation for persistent epithelial defect in severe ocular surface diseases with acute inflammatory exercise.

Antianxiety-like results of Chimpi (dried citrus peels) in the elevated open-platform check.

Dried citrus peels (Chimpi) is likely one of the most typical pure medicines with qi (power circulate) rectifying and shi (dampness) drying actions, which originates from Citrus unshiu, and/or C. reticulata in response to the definition of the pharmacopoeiae of Japan and China. In this examine, the pharmacological results of their extracts and main chemical constituents hesperidin and its aglycone hesperetin on nervousness had been examined with an nervousness mannequin of elevated open-platform check utilizing ICR male mice (6-week-old) and whole period of freezing was decreased in fluoxetine-treated mice, which is a straightforward and extremely delicate to the consequences of serotonergic anxiolytics.

EDTA, Disodium Salt, Dihydrate

CH033 1.0 kg
EUR 195.00

EDTA, disodium salt, dihydrate

EB0185 500g
EUR 70.01
  • Product category: Biochemicals/Misc. Biochemicals

EDTA disodium salt dihydrate

GE3023-100G 100 g
EUR 40.00

EDTA disodium salt dihydrate

GE3023-1KG 1 kg
EUR 70.00

EDTA disodium salt dihydrate

GE3023-250G 250 g
EUR 46.00

EDTA disodium salt dihydrate

GE3023-500G 500 g
EUR 54.00

EDTA disodium salt dihydrate

GE3023-5KG 5 kg
EUR 150.00

EDTA copper(II) disodium salt

EB0434 250g
EUR 83.93
  • Product category: Biochemicals/Misc. Biochemicals

EDTA disodium and monomagnesium salt

EB0435 500g
EUR 110.90
  • Product category: Biochemicals/Misc. Biochemicals

EDTA zinc (II), disodium salt

EB6666 100g
EUR 64.79
  • Product category: Biochemicals/Misc. Biochemicals

EDTA disodium and monocalcium salt

EK014P2 500g
EUR 96.11
  • Product category: Biochemicals/Misc. Biochemicals

EDTA magnesium disodium salt hydrate

GE3956-100G 100 g
EUR 66.00

EDTA magnesium disodium salt hydrate

GE3956-1KG 1 kg
EUR 245.00

EDTA magnesium disodium salt hydrate

GE3956-250G 250 g
EUR 102.00

EDTA magnesium disodium salt hydrate

GE3956-25G 25 g
EUR 45.00

EDTA magnesium disodium salt hydrate

GE3956-500G 500 g
EUR 154.00

EDTA disodium zinc salt hydrate

GX3802-100G 100 g
EUR 54.00

EDTA disodium zinc salt hydrate

GX3802-250G 250 g
EUR 75.00

EDTA disodium zinc salt hydrate

GX3802-25G 25 g
EUR 43.00

EDTA disodium zinc salt hydrate

GX3802-500G 500 g
EUR 110.00

EDTA manganese disodium salt hydrate

GX6009-100G 100 g
EUR 102.00

EDTA manganese disodium salt hydrate

GX6009-250G 250 g
EUR 174.00

EDTA manganese disodium salt hydrate

GX6009-25G 25 g
EUR 58.00

EDTA manganese disodium salt hydrate

GX6009-500G 500 g
EUR 269.00

EDTA calcium disodium salt dihydrate, BP, Ph. Eur., USP grade

GE8581-1KG 1 kg
EUR 201.00

EDTA calcium disodium salt dihydrate, BP, Ph. Eur., USP grade

GE8581-250G 250 g
EUR 86.00

EDTA calcium disodium salt dihydrate, BP, Ph. Eur., USP grade

GE8581-500G 500 g
EUR 126.00

Hypoxanthine Disodium Salt

B1185-1G
EUR 109.00

Hypoxanthine Disodium Salt

B1185-5G
EUR 240.00

BCIP disodium salt

BB1171 500mg
EUR 232.70
  • Product category: Biochemicals/Indicators/Stains/DNA/RNA/Protein Related

cGAMP disodium salt

2435-100
EUR 196.00

NADH, disodium salt

2735-1000
EUR 169.00

NADH, disodium salt

2735-500
EUR 142.00

NADH, disodium salt

2735-5000
EUR 544.00

NADP, disodium salt

2736-100
EUR 153.00

NADP, disodium salt

2736-1000
EUR 784.00

NADP, disodium salt

2736-500
EUR 457.00

NBQX disodium salt

2759-25
EUR 642.00

NBQX disodium salt

2759-5
EUR 207.00

Carbenicillin, Disodium Salt

A2511-5.1 10 mM (in 1mL DMSO)
EUR 108.00
Description: Carbenicillin inhibits the cell-wall synthesis (peptidoglycan cross-linking) by inactivating transpeptidase on the inner surface of the bacterial cell membrane.Carbenicillin is a white to slightly yellow, hygroscopic powder soluble in water and in alcohol.

Carbenicillin, Disodium Salt

A2511-50 50 mg
EUR 131.00
Description: Carbenicillin inhibits the cell-wall synthesis (peptidoglycan cross-linking) by inactivating transpeptidase on the inner surface of the bacterial cell membrane.Carbenicillin is a white to slightly yellow, hygroscopic powder soluble in water and in alcohol.

BCA disodium salt

2810-100G
EUR 865.00

BCA disodium salt

2810-1G
EUR 120.00

BCA disodium salt

2810-500G
EUR 2605.00

BCA disodium salt

2810-5G
EUR 218.00

ATP disodium salt

B3304-5.1 10 mM (in 1mL H2O)
EUR 108.00
Description: ATP Disodium salt is a P2 purinoceptor agonist.

ATP disodium salt

B3304-50 50 mg
EUR 128.00
Description: ATP Disodium salt is a P2 purinoceptor agonist.

ATP disodium salt

B3304-S Evaluation Sample
EUR 81.00
Description: ATP Disodium salt is a P2 purinoceptor agonist.

UDP disodium salt

B7278-5.1 10 mM (in 1mL DMSO)
EUR 108.00

UDP disodium salt

B7278-50 50 mg
EUR 125.00

Phosphocreatine disodium salt

B7648-25 25 mg
EUR 196.00

DNQX disodium salt

B5288-100 100 mg
EUR 279.00

DNQX disodium salt

B5288-25 25 mg
EUR 128.00

DNQX disodium salt

B5288-50 50 mg
EUR 186.00

NBQX disodium salt

B6566-10 10 mg
EUR 222.00

NBQX disodium salt

B6566-25 25 mg
EUR 389.00

NBQX disodium salt

B6566-5 5 mg
EUR 139.00

NBQX disodium salt

B6566-50 50 mg
EUR 683.00

CNQX disodium salt

B6567-1 1 mg
EUR 134.00

CNQX disodium salt

B6567-10 10 mg
EUR 215.00

CNQX disodium salt

B6567-50 50 mg
EUR 746.00

Phosphoramidon Disodium Salt

B4790-25 25 mg
EUR 490.00
Description: Phosphoramidon Disodium Salt is a potent inhibitor of metalloproteinase [1]. Metalloproteinase is an enzyme whose catalytic mechanism involves a metal. Most metalloproteases require zinc and some require cobalt.

Phosphoramidon Disodium Salt

B4790-5 5 mg
EUR 189.00
Description: Phosphoramidon Disodium Salt is a potent inhibitor of metalloproteinase [1]. Metalloproteinase is an enzyme whose catalytic mechanism involves a metal. Most metalloproteases require zinc and some require cobalt.

Dimethylglyoxime disodium salt

DD1221 100g
EUR 63.92
  • Product category: Biochemicals/Misc. Biochemicals

Fluorescein, disodium salt

FB0203 100g
EUR 63.92
  • Product category: Biochemicals/Indicators/Stains/Other

POPSO, disodium salt

PB4959 25g
EUR 76.97
  • Product category: Biochemicals/Biological Buffers/Common Buffers

Methoxatin (disodium salt)

HY-100196A 10mM/1mL
EUR 186.00

NADH (disodium salt)

HY-F0001 10mM/1mL
EUR 113.00

NADP (disodium salt)

HY-F0002A 500mg
EUR 271.00

ATP (disodium salt)

HY-B0345A 10mM/1mL
EUR 113.00

Carbenicillin disodium salt

GA1299-10G 10 g
EUR 229.00

Carbenicillin disodium salt

GA1299-1G 1 g
EUR 86.00

Carbenicillin disodium salt

GA1299-250MG 250 mg
EUR 59.00

Carbenicillin disodium salt

GA1299-25G 25 g
EUR 341.00

Carbenicillin disodium salt

GA1299-5G 5 g
EUR 158.00

Ticarcillin disodium salt

GA1874-100MG 100 mg
EUR 50.00

Ticarcillin disodium salt

GA1874-1G 1 g
EUR 110.00

Ticarcillin disodium salt

GA1874-500MG 500 mg
EUR 78.00

Cefotetan disodium salt

GA5476-100MG 100 mg
EUR 86.00

Cefotetan disodium salt

GA5476-1G 1 g
EUR 181.00

Phosphomycin disodium salt

GA7173-1G 1 g
EUR 70.00

Phosphomycin disodium salt

GA7173-25G 25 g
EUR 289.00

Phosphomycin disodium salt

GA7173-5G 5 g
EUR 134.00

ADA disodium salt

GB0256-100G 100 g
EUR 110.00

ADA disodium salt

GB0256-500G 500 g
EUR 341.00

PIPES disodium salt

GB1799-100G 100 g
EUR 110.00

PIPES disodium salt

GB1799-250G 250 g
EUR 181.00

PIPES disodium salt

GB1799-25G 25 g
EUR 70.00

PIPES disodium salt

GB1799-500G 500 g
EUR 309.00

POPSO disodium salt

GB6170-100G 100 g
EUR 269.00

POPSO disodium salt

GB6170-25G 25 g
EUR 126.00

Balsalazide disodium salt

GP7647-1G 1 g
EUR 110.00

Etidronate disodium salt

GP3560-1G 1 g
EUR 174.00

Lobenzarit disodium salt

GP3753-100MG 100 mg
EUR 229.00

cGAMP disodium salt

GL2101-100UG 100 ug
EUR 160.00

cGAMP disodium salt

GL2101-500UG 500 ug
EUR 332.00

EDTA, tetrasodium salt dihydrate

EB0436 500g
EUR 88.28
  • Product category: Biochemicals/Misc. Biochemicals

EDTA, dipotassium salt, dihydrate

ED0075 250g
EUR 83.06
  • Product category: Biochemicals/Misc. Biochemicals

EDTA tetrasodium salt hydrate

GE3450-100G 100 g
EUR 41.00

EDTA tetrasodium salt hydrate

GE3450-1KG 1 kg
EUR 68.00

EDTA tetrasodium salt hydrate

GE3450-250G 250 g
EUR 45.00

EDTA tetrasodium salt hydrate

GE3450-500G 500 g
EUR 53.00

EDTA tetrasodium salt hydrate

GE3450-5KG 5 kg
EUR 166.00

EDTA dipotassium salt dihydrate

GE5635-100G 100 g
EUR 54.00

EDTA dipotassium salt dihydrate

GE5635-250G 250 g
EUR 74.00

EDTA dipotassium salt dihydrate

GE5635-500G 500 g
EUR 102.00

EDTA ferric sodium salt

GE7700-100G 100 g
EUR 44.00

EDTA ferric sodium salt

GE7700-1KG 1 kg
EUR 98.00

EDTA ferric sodium salt

GE7700-250G 250 g
EUR 54.00

EDTA ferric sodium salt

GE7700-500G 500 g
EUR 70.00

EDTA trisodium salt dihydrate

GE9701-100G 100 g
EUR 54.00

EDTA trisodium salt dihydrate

GE9701-250G 250 g
EUR 78.00

EDTA trisodium salt dihydrate

GE9701-500G 500 g
EUR 118.00

EDTA tetrasodium salt dihydrate

GK0795-100G 100 g
EUR 40.00

EDTA tetrasodium salt dihydrate

GK0795-1KG 1 kg
EUR 70.00

EDTA tetrasodium salt dihydrate

GK0795-2500G 2500 g
EUR 118.00

EDTA tetrasodium salt dihydrate

GK0795-250G 250 g
EUR 46.00

EDTA tetrasodium salt dihydrate

GK0795-500G 500 g
EUR 53.00

EDTA tripotassium salt dihydrate

GL1464-100G 100 g
EUR 61.00

EDTA tripotassium salt dihydrate

GL1464-250G 250 g
EUR 86.00

EDTA tripotassium salt dihydrate

GL1464-25G 25 g
EUR 44.00

EDTA tripotassium salt dihydrate

GL1464-500G 500 g
EUR 128.00

ADA buffer, disodium salt

AB0005 25g
EUR 66.53
  • Product category: Biochemicals/Biological Buffers/Common Buffers

(RS)-MCPG disodium salt

B7476-10 10 mg
EUR 302.00

(RS)-MCPG disodium salt

B7476-50 50 mg
EUR 1114.00

Pamoic acid disodium salt

B7638-10 10 mg
EUR 480.00

Pamoic acid disodium salt

B7638-50 50 mg
EUR 1861.00

CL 316243 disodium salt

B6766-1 1 mg
EUR 109.00
Description: EC50: (3.0±0.3) X 10-8 M for ?3 adrenoceptor [1].Benzodioxole-containing phenethanolamine CL-316,243 is a murine-selective ?3 adrenoceptor agonist which can correct obesity and elevated blood glucose in diabetic rodents.

CL 316243 disodium salt

B6766-10 10 mg
EUR 293.00
Description: EC50: (3.0±0.3) X 10-8 M for ?3 adrenoceptor [1].Benzodioxole-containing phenethanolamine CL-316,243 is a murine-selective ?3 adrenoceptor agonist which can correct obesity and elevated blood glucose in diabetic rodents.

CL 316243 disodium salt

B6766-5 5 mg
EUR 206.00
Description: EC50: (3.0±0.3) X 10-8 M for ?3 adrenoceptor [1].Benzodioxole-containing phenethanolamine CL-316,243 is a murine-selective ?3 adrenoceptor agonist which can correct obesity and elevated blood glucose in diabetic rodents.

MUP, disodium salt, trihydrate

M0740 1g
EUR 93.50
  • Product category: Biochemicals/Indicators/Stains/Other

UDP-GlcNAc Disodium Salt

HY-112174 5mg
EUR 165.00

Clodronate disodium salt hydrate

GP6103-1G 1 g
EUR 86.00

Bathocuproinedisulfonic acid disodium salt

GT0734-100MG 100 mg
EUR 50.00

Bathocuproinedisulfonic acid disodium salt

GT0734-1G 1 g
EUR 110.00

Bathocuproinedisulfonic acid disodium salt

GT0734-250MG 250 mg
EUR 62.00

Bathocuproinedisulfonic acid disodium salt

GT0734-500MG 500 mg
EUR 80.00

Pamoic acid disodium salt

GK6564-100G 100 g
EUR 86.00

Pamoic acid disodium salt

GK6564-250G 250 g
EUR 142.00

Pamoic acid disodium salt

GK6564-25G 25 g
EUR 54.00

Sulfobromophthalein disodium salt hydrate

GK6995-25G 25 g
EUR 245.00

Sulfobromophthalein disodium salt hydrate

GK6995-5G 5 g
EUR 110.00

EDTA, Iron (III), sodium salt

EB0437 100g
EUR 65.66
  • Product category: Biochemicals/Misc. Biochemicals

MUP, disodium salt [4-Methylumbelliferyl phosphate, disodium salt] *CAS 22919-26-2*

11610 25 mg
EUR 115.00
  • R-phrase: R20, R21, R22
  • H-Phrase: H303, H313, H333
  • Symbol for dangerous compounds: Xn
  • UNSPEC Code: 12171501

MUP, disodium salt [4-Methylumbelliferyl phosphate, disodium salt] *CAS 22919-26-2*

11612 10 g
EUR 898.00
  • R-phrase: R20, R21, R22
  • H-Phrase: H303, H313, H333
  • Symbol for dangerous compounds: Xn
  • UNSPEC Code: 12171501

BCA (Bicinchoninic acid), disodium salt

BB0260 5g
EUR 154.40
  • Product category: Biochemicals/Biology Reagents/Protein Related

DL-?-Hydroxyglutaric acid disodium salt

A3837-100 100 mg
EUR 186.00
Description: IC50: N/AD-?-Hydroxyglutaric acid, an ?-hydroxy acid formed from the hydrolysis of (R)-5-oxo-2-tetrahydrofurancarboxylic acid, is over-produced in the human neurometabolic disease D-?-hydroxyglutaric aciduria.

DL-?-Hydroxyglutaric acid disodium salt

A3837-25 25 mg
EUR 118.00
Description: IC50: N/AD-?-Hydroxyglutaric acid, an ?-hydroxy acid formed from the hydrolysis of (R)-5-oxo-2-tetrahydrofurancarboxylic acid, is over-produced in the human neurometabolic disease D-?-hydroxyglutaric aciduria.

DL-?-Hydroxyglutaric acid disodium salt

A3837-50 50 mg
EUR 154.00
Description: IC50: N/AD-?-Hydroxyglutaric acid, an ?-hydroxy acid formed from the hydrolysis of (R)-5-oxo-2-tetrahydrofurancarboxylic acid, is over-produced in the human neurometabolic disease D-?-hydroxyglutaric aciduria.

Guanosine 5'-triphosphate disodium salt

20-abx180774
  • EUR 300.00
  • EUR 565.00
  • 1 g
  • 5 g
  • Shipped within 1-2 weeks.

Chromotropic Acid Disodium Salt Dihydrate

20-abx186412
  • EUR 328.00
  • EUR 230.00
  • 100 g
  • 25 g
  • Shipped within 1-2 weeks.

L-?-Hydroxyglutaric Acid Disodium Salt

B2812-25
EUR 349.00

L-?-Hydroxyglutaric Acid Disodium Salt

B2812-5
EUR 131.00

Creatine phosphate, disodium salt, Tetrahydrate

CB0128 5g
EUR 70.88
  • Product category: Biochemicals/Misc. Biochemicals

NADH disodium salt, trihydrate, reduced

NB0642 1g
EUR 82.19
  • Product category: Biochemicals/Nucleic Acids/Derivatives

Guanosine 5'-diphosphate disodium salt

HY-113066A 10mg
EUR 119.00

Glycerophosphoric acid (disodium salt hydrate)

HY-126304 100mg
EUR 108.00

Oleanolic acid hemiphthalate disodium salt

HY-128695 10mM/1mL
EUR 625.00

Uridine 5′-diphosphoglucose (disodium salt)

HY-N7032 100mg
EUR 108.00

Uridine-5'-diphosphate disodium salt

HY-W010832 100mg
EUR 108.00

5'-Guanylic acid (disodium salt)

HY-W010970 10mM/1mL
EUR 113.00

Uridine 5'-monophosphate disodium salt

HY-W013175 100mg
EUR 108.00

Ceftriaxone disodium salt hemi(heptahydrate)

GA6812-1G 1 g
EUR 62.00

Ceftriaxone disodium salt hemi(heptahydrate)

GA6812-25G 25 g
EUR 229.00

Ceftriaxone disodium salt hemi(heptahydrate)

GA6812-5G 5 g
EUR 94.00

Uridine 5'-diphosphate disodium salt

GC9934-100MG 100 mg
EUR 74.00

Uridine 5'-diphosphate disodium salt

GC9934-1G 1 g
EUR 261.00

Uridine 5'-diphosphate disodium salt

GC9934-250MG 250 mg
EUR 110.00

Uridine 5'-diphosphate disodium salt

GC9934-25MG 25 mg
EUR 52.00

Uridine 5'-diphosphate disodium salt

GC9934-500MG 500 mg
EUR 162.00

Phenyl phosphate disodium salt dihydrate

GE1672-100G 100 g
EUR 150.00

Phenyl phosphate disodium salt dihydrate

GE1672-10G 10 g
EUR 52.00

Phenyl phosphate disodium salt dihydrate

GE1672-25G 25 g
EUR 74.00

Phenyl phosphate disodium salt dihydrate

GE1672-50G 50 g
EUR 99.00

Guanosine-5'-triphosphate disodium salt

GE2026-1G 1 g
EUR 229.00

Guanosine 5'-diphosphate disodium salt

GE3702-100MG 100 mg
EUR 118.00

Guanosine 5'-diphosphate disodium salt

GE3702-250MG 250 mg
EUR 174.00

Adenosine 5'-diphosphate disodium salt

GE3988-1G 1 g
EUR 78.00

Adenosine 5'-diphosphate disodium salt

GE3988-250MG 250 mg
EUR 50.00

L-Tyrosine disodium salt hydrate

GE4061-100G 100 g
EUR 84.00

L-Tyrosine disodium salt hydrate

GE4061-25G 25 g
EUR 48.00

L-Tyrosine disodium salt hydrate

GE4061-50G 50 g
EUR 61.00

Uridine 5'-monophosphate disodium salt

GE7138-100G 100 g
EUR 269.00

Uridine 5'-monophosphate disodium salt

GE7138-25G 25 g
EUR 110.00

Uridine 5'-monophosphate disodium salt

GE7138-5G 5 g
EUR 62.00

4-Methylumbelliferyl phosphate disodium salt

GC5745-1G 1 g
EUR 166.00

4-Methylumbelliferyl phosphate disodium salt

GC5745-250MG 250 mg
EUR 75.00

Hydroxy naphthol blue disodium salt

GT4927-100G 100 g
EUR 102.00

Hydroxy naphthol blue disodium salt

GT4927-25G 25 g
EUR 62.00

DL-Malic acid disodium salt

GX1468-100G 100 g
EUR 46.00

Moreover, yokukansankachimpihange (YKH), a mix of yokukansan with Chimpi and Hange (Pinellia) was additionally examined as a result of Chimpi is taken into account to play an important half in this formulation in opposition to anxious signs in dementia sufferers.

The outcomes confirmed that Chimpi and YKH possess a major anxiolytic-like impact much like that of fluoxetine, suggesting that they could be much like fluoxetine in their pharmacological actions by way of the serotonergic neurotransmission pathway.

Moreover, it additionally advised that the main chemical constituent, hesperidin may very well be an lively precept attributed to the antianxiety-like results with a direct and oblique position through its aglycone hesperetin.