FLX pyrosequencing analysis of the effects of the brown-algal fermentable polysaccharides alginate and laminaran on rat cecal microbiotas.

FLX pyrosequencing analysis of the effects of the brown-algal fermentable polysaccharides alginate and laminaran on rat cecal microbiotas.

Edible brown algae are used as main meals materials in Far East Asian international locations, significantly in South Korea and Japan. They comprise fermentable dietary fibers, alginic acid (uronic acid polymer) and laminaran (β-1,3-glucan), which can be fermented into natural acids by intestinal micro organism.

To make clear the impact of edible algae on the intestinal setting, the cecal microbiotas of rats fed diets containing no dietary fiber (management) or 2% (wt/wt) sodium alginate or laminaran for two weeks have been analyzed utilizing FLX amplicon pyrosequencing with bar-coded primers focusing on the bacterial 16S rRNA gene. The most considerable phylum in all teams was Firmicutes.

Specifically, Allobaculum was dominant in all food regimen teams. In addition, Bacteroides capillosus (37.1%) was considerable in the alginate group, whereas Clostridium ramosum (3.14%) and Parabacteroides distasonis (1.36%) have been solely detected in the laminaran group. Furthermore, rats fed alginate confirmed simplified microbiota phylotypes in contrast with others. With respect to cecal chemical compounds, laminaran increased cecal natural acid ranges, significantly propionic acid. Alginate elevated complete cecal natural acids.

Cecal putrefactive compounds, comparable to indole, H(2)S, and phenol, have been decreased by each alginate and laminaran. These outcomes point out that edible brown algae can alter the intestinal setting, with fermentation by intestinal microbiota.

FLX pyrosequencing analysis of the effects of the brown-algal fermentable polysaccharides alginate and laminaran on rat cecal microbiotas.
FLX pyrosequencing analysis of the effects of the brown-algal fermentable polysaccharides alginate and laminaran on rat cecal microbiotas.

Tsunami lung.

We encountered three instances of lung issues attributable to drowning in the current massive tsunami that struck following the Great East Japan Earthquake. All three have been females, and two of them have been outdated aged. All segments of each lungs have been concerned in all the three sufferers, necessitating ICU admission and endotracheal intubation and mechanical air flow. All three died inside 3 weeks.

EDEM3 Antibody

45972-50ul 50ul
EUR 187

EDEM3 Antibody

DF9504 200ul
EUR 304
Description: EDEM3 Antibody detects endogenous levels of total EDEM3.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EDEM3 Antibody

ABD9504 100 ug
EUR 438

EDEM3 Blocking Peptide

EUR 153

EDEM3 Blocking Peptide

DF9504-BP 1mg
EUR 195

EDEM3 Polyclonal Antibody

ABP58454-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human EDEM3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of EDEM3 from Human, Mouse. This EDEM3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human EDEM3 protein

EDEM3 Polyclonal Antibody

ABP58454-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human EDEM3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of EDEM3 from Human, Mouse. This EDEM3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human EDEM3 protein

EDEM3 Polyclonal Antibody

ABP58454-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human EDEM3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of EDEM3 from Human, Mouse. This EDEM3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human EDEM3 protein

Polyclonal EDEM3 Antibody

AMM07005G 0.1mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human EDEM3 . This antibody is tested and proven to work in the following applications:

EDEM3 Conjugated Antibody

C45972 100ul
EUR 397

EDEM3 cloning plasmid

CSB-CL863170HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 369
  • Sequence: atgggaggctttaagtatggtgatgaacaaccacgttctgactggcgtagttatcgtaggaatctggagcatgctgtgttagaattgaccttgtttaaaactgtcccatcaaaaatggaaatccacagttcccccttcaaatgcagcactgcaccaccctgcaacacctcaggcca
  • Show more
Description: A cloning plasmid for the EDEM3 gene.

EDEM3 Polyclonal Antibody

ES9649-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against EDEM3 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

EDEM3 Polyclonal Antibody

ES9649-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against EDEM3 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

Anti-EDEM3 antibody

STJ190807 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to EDEM3

Mouse Edem3 ELISA KIT

ELI-26645m 96 Tests
EUR 865

Mouse EDEM3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human EDEM3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


ELI-47172h 96 Tests
EUR 824

Edem3 ORF Vector (Rat) (pORF)

ORF066352 1.0 ug DNA
EUR 506

EDEM3 ORF Vector (Human) (pORF)

ORF003388 1.0 ug DNA
EUR 95

Edem3 ORF Vector (Mouse) (pORF)

ORF043621 1.0 ug DNA
EUR 506

EDEM3 sgRNA CRISPR Lentivector set (Human)

K0653601 3 x 1.0 ug
EUR 339

Edem3 sgRNA CRISPR Lentivector set (Rat)

K6190401 3 x 1.0 ug
EUR 339

Edem3 sgRNA CRISPR Lentivector set (Mouse)

K3468201 3 x 1.0 ug
EUR 339

EDEM3 sgRNA CRISPR Lentivector (Human) (Target 1)

K0653602 1.0 ug DNA
EUR 154

EDEM3 sgRNA CRISPR Lentivector (Human) (Target 2)

K0653603 1.0 ug DNA
EUR 154

EDEM3 sgRNA CRISPR Lentivector (Human) (Target 3)

K0653604 1.0 ug DNA
EUR 154

Edem3 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6190402 1.0 ug DNA
EUR 154

Edem3 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6190403 1.0 ug DNA
EUR 154

Edem3 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6190404 1.0 ug DNA
EUR 154

Edem3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3468202 1.0 ug DNA
EUR 154

Edem3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3468203 1.0 ug DNA
EUR 154

Edem3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3468204 1.0 ug DNA
EUR 154

EDEM3 Protein Vector (Mouse) (pPB-C-His)

PV174482 500 ng
EUR 1065

EDEM3 Protein Vector (Mouse) (pPB-N-His)

PV174483 500 ng
EUR 1065

EDEM3 Protein Vector (Mouse) (pPM-C-HA)

PV174484 500 ng
EUR 1065

EDEM3 Protein Vector (Mouse) (pPM-C-His)

PV174485 500 ng
EUR 1065

EDEM3 Protein Vector (Rat) (pPB-C-His)

PV265406 500 ng
EUR 1166

EDEM3 Protein Vector (Rat) (pPB-N-His)

PV265407 500 ng
EUR 1166

EDEM3 Protein Vector (Rat) (pPM-C-HA)

PV265408 500 ng
EUR 1166

EDEM3 Protein Vector (Rat) (pPM-C-His)

PV265409 500 ng
EUR 1166

EDEM3 Protein Vector (Human) (pPB-C-His)

PV013549 500 ng
EUR 329

EDEM3 Protein Vector (Human) (pPB-N-His)

PV013550 500 ng
EUR 329

EDEM3 Protein Vector (Human) (pPM-C-HA)

PV013551 500 ng
EUR 329

EDEM3 Protein Vector (Human) (pPM-C-His)

PV013552 500 ng
EUR 329

Edem3 3'UTR GFP Stable Cell Line

TU155599 1.0 ml Ask for price

Edem3 3'UTR Luciferase Stable Cell Line

TU105599 1.0 ml Ask for price

Edem3 3'UTR Luciferase Stable Cell Line

TU203778 1.0 ml Ask for price

Edem3 3'UTR GFP Stable Cell Line

TU253778 1.0 ml Ask for price

EDEM3 3'UTR GFP Stable Cell Line

TU056561 1.0 ml
EUR 2333

EDEM3 3'UTR Luciferase Stable Cell Line

TU006561 1.0 ml
EUR 2333

ER Degradation-Enhancing Alpha-Mannosidase-Like Protein 3 (EDEM3) Antibody

  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

ER Degradation-Enhancing Alpha-Mannosidase-Like Protein 3 (EDEM3) Antibody

abx028901-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

ER Degradation-Enhancing Alpha-Mannosidase-Like Protein 3 (EDEM3) Antibody

abx028901-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

EDEM3 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0653605 3 x 1.0 ug
EUR 376

Edem3 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6190405 3 x 1.0 ug
EUR 376

Edem3 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3468205 3 x 1.0 ug
EUR 376

EDEM3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K0653606 1.0 ug DNA
EUR 167

EDEM3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K0653607 1.0 ug DNA
EUR 167

EDEM3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K0653608 1.0 ug DNA
EUR 167

Edem3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K6190406 1.0 ug DNA
EUR 167

Edem3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K6190407 1.0 ug DNA
EUR 167

Edem3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K6190408 1.0 ug DNA
EUR 167

Edem3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K3468206 1.0 ug DNA
EUR 167

Edem3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K3468207 1.0 ug DNA
EUR 167

Edem3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K3468208 1.0 ug DNA
EUR 167

In no less than two instances, misswallowing of oil was suspected from the options famous at the time of the detection. Sputum tradition for micro organism yielded isolation of Stenotrophomonas maltophilia, Legionella pneumophila, Burkholderia cepacia, and Pseudomonas aeruginosa. The trigger of tsunami lung could also be a mix of chemical induced pneumonia and bacterial pneumonia.